SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00249  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA000560
Annotation
PREDICTED:_serine/threonine-protein_kinase_OSR1-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 3.459
 

Sequence

CDS
ATGGCAGCCAGTACAAACACAAACACGATTCCTTGGTCAAATACCGAAGATGACTATGAAATAGGGGATGTAATCGGTGTTGGTGCCACAGCAGTAGTGTACAGTGCATACTGTAAGCCAAGAGGTGAAAAGTGTGCTATAAAAAGAATAAATTTAGAAAAATGGAATACTTCGATGGATGAGTTATTAAAGGAAATACAGGCAATGTCAAGTTGTAATCATGAGAATGTCGTTACATATTATACAAGTTTTGTGGTGCATGATGAGCTGTGGTTGATCTTAAAGCTTCTTGAAGGAGGCAGTCTTTTAGATGTCATCAAACATAAAATAAGAGTAAGCAATTGTGTCAATGGAGTTTTTGATGAAGCTACAATTGCTACTGTTTTAAAGGAAGTGCTAAAAGGTTTGGAATATTTCCATAGCAATGGACAAATCCACAGGGATGTCAAAGCTGGTAATATATTACTAGGTGAAGATGGAACTGTGCAGTTGGCAGATTTTGGTGTTTCTGCATGGCTGGCTACTGGTAGAGATATGTCTAGACAAAAAGTTAGACATACTTTTGTTGGTACACCATGCTGGATGGCACCAGAAGTCATGGAACAAGATCATGGCTATGATTTCAAAGCTGACATTTGGTCATTTGGAATAACTGCCATAGAAATGGCTACAGGAACTGCTCCATACCATAAATACCCTCCAATGAAAGTGTTGATGTTGACATTGCAGAATGATCCTCCTAATTTAGATACAGGAGCTGAAGAAAAAGATCAATATAAAGCTTATGGGAAAACATTCAGGAAAATGATAGTGGATTGCTTACAAAAGGATCCAACCAAGCGTCCAACTGCTACAGAGTTGTTAAAGCATCCTTTTTTCAAAAAAGCCAAAGATAGAAAATATTTAACTCAAACTTTGGTTGCCATAGGGCCCAGCATGGAAACTAGAGTAACAAAGGCAAGCAAAAAGCATTCTGCTACGTCAGGTCGTCTTCATCGTACAATGACTGGAGAATGGGTGTGGAGTGAAGAAGAGGAAGGCGGTGTTGATTCCGATGATGATACTCCTACCAAAGATGATCAACTTCCTATGAACAAGATTCAAAAGGCAGAATCTAGTGCCAGTGAAAATGAAGACGAAATTTCAACTGATTCTAAGCAACAGCCAGTTCAGCCGCAACAAACACAGCCTCAAGTAGTCCAGGCGCAACCACTATCGAATATGTCTCAGACCCAATCACTACAGGCATTGCCACAACCACACCAAACACAGCTACCTGCACAAAAATTGCAACTAGATCAACCGCTATCTCAATCTACATCGCAGCAGCCGCAAGCTGCGCAGCCACAGCGTCAAGTCGTTCAGCCGCAGTTATTGTTGGCACAGCCACAATCCCAACCGCAAATTATTGCGTCGCAACCGCGAATGATGCAATCGCAGTCACAAATGGTTCAGCCCCAACCACAGTCGCTACAGTTACAATCACAATTGGTGCAGGCGCAAAATCAATTACAGGCGGCAACCACACAACCGCAATCAGCACAGATGCCACCGCAATTGGCACTACCACATCCTCAATTGGCATTGCCACAATTGCAATCAGCACTGCCACAATTGCAATCGGCTCTGCCACAATTGCAAACAGCTCTGCCACAACTACAATCTGCTCTGCCACAACTGCAATGTGGTGTATCACAGTTGCAATCGGGAATGCTGCAACTGCAGTCAAATTTACCCCAAATGCAATCGGTATTACCCCAATTGCAATCGTCAATACCGCAATTACAACCAGTACTACCGCAAATGCAATCAGCACAGCCGCAACCTCAATCAGCACAGCCACAACCCCAATCACCACAGCCGCAACACCAATCGGCACAGCCGCAACCCCAATCGGCACAGCCGCAACCCCAATCAGTACAGCCGCAACCCCAATCAGTACAACCGCAACCCCAATCAACACAACTGCAACCCCAATCAGCACAACCGCAACTACAATTGGCACAGTCAAACCCGCAATCAACACAGCCAAAACCCCCACCAGTGCAACCAAAACCACAACCAACTCAGTCGCAGTCGCAACCTGAACAACCACCAAAAGCACAACCTGTTATTATGAAGATTGTTCCCACAGTTGTCAATTTGGTCCTAAGATTGAGGAATTCTCGCGGCGAGTTAAATGACATTCGATTTGAGTACGTCATTGGGAAGGACACTGCTGAAGGGATAGCTTCAGAACTAGTAGGTGCTGGGTTGATTGACCCTAATGATTCAGTGCCTATATCGTCGAATTTGGCAAAACTACTTAATGGCCATGTTGCTGCTATGCAGACCGCTCCTAAAGCTATTACATTCCATTTGAATTCATCCAGGCCCAATCAAACTTATGACGACAAAGCTTTGATTGGATTTGCACAAATAACAATCGTTGAGTAA
Protein
MAASTNTNTIPWSNTEDDYEIGDVIGVGATAVVYSAYCKPRGEKCAIKRINLEKWNTSMDELLKEIQAMSSCNHENVVTYYTSFVVHDELWLILKLLEGGSLLDVIKHKIRVSNCVNGVFDEATIATVLKEVLKGLEYFHSNGQIHRDVKAGNILLGEDGTVQLADFGVSAWLATGRDMSRQKVRHTFVGTPCWMAPEVMEQDHGYDFKADIWSFGITAIEMATGTAPYHKYPPMKVLMLTLQNDPPNLDTGAEEKDQYKAYGKTFRKMIVDCLQKDPTKRPTATELLKHPFFKKAKDRKYLTQTLVAIGPSMETRVTKASKKHSATSGRLHRTMTGEWVWSEEEEGGVDSDDDTPTKDDQLPMNKIQKAESSASENEDEISTDSKQQPVQPQQTQPQVVQAQPLSNMSQTQSLQALPQPHQTQLPAQKLQLDQPLSQSTSQQPQAAQPQRQVVQPQLLLAQPQSQPQIIASQPRMMQSQSQMVQPQPQSLQLQSQLVQAQNQLQAATTQPQSAQMPPQLALPHPQLALPQLQSALPQLQSALPQLQTALPQLQSALPQLQCGVSQLQSGMLQLQSNLPQMQSVLPQLQSSIPQLQPVLPQMQSAQPQPQSAQPQPQSPQPQHQSAQPQPQSAQPQPQSVQPQPQSVQPQPQSTQLQPQSAQPQLQLAQSNPQSTQPKPPPVQPKPQPTQSQSQPEQPPKAQPVIMKIVPTVVNLVLRLRNSRGELNDIRFEYVIGKDTAEGIASELVGAGLIDPNDSVPISSNLAKLLNGHVAAMQTAPKAITFHLNSSRPNQTYDDKALIGFAQITIVE

Summary

Uniprot
ProteinModelPortal
PDB
2VWI     E-value=5.19918e-123,     Score=1132

Ontologies

Topology

Length:
811
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.306730000000001
Exp number, first 60 AAs:
0.14663
Total prob of N-in:
0.01418
outside
1  -  811
 
 

Population Genetic Test Statistics

Pi
13.075012
Theta
16.357441
Tajima's D
-1.157018
CLR
0.008326
CSRT
0.110544472776361
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28467696 HTFEPIGQNVTHCNK 100.00 8e-14
28467696 HTFVGTPCWMAPEVMEQDHGYDFK 95.83 4e-13
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号