SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00234
Pre Gene Modal
BGIBMGA000645
Annotation
PREDICTED:_glutamate_receptor_1-like_[Bombyx_mori]
Full name
Glutamate receptor 1      
Alternative Name
Glutamate receptor I
Kainate-selective glutamate receptor
Location in the cell
PlasmaMembrane   Reliability : 3.565
 

Sequence

CDS
ATGCTAACTATAAATATTCGGCGTTTGATTGTTCGTGAACATGTGCTGCATACATGTAGCATTGTCTGCAATCAATTCGGACGTGGGGTAATGGCGATGCTGGGTGCTGTAACTCCGGACTCCTTCGACACTCTGCACTCGTATTCCAACACCTTCCAGATGCCGTTCGTGACCCCCTGGTTTCCTGAAAAGGTTATACCACCGTCATCGGGCCTCATCGATTATGCCGTCAGCATGCGACCGGACTACCACCGAGCTGTCATCGACACCATCACCTTCTATGGTTGGAAGAACGTCATATACGTGTATGATTCCCACGACGGTCTGCTTCGCCTCCAGCAACTGTACCAAAGTCTGCAACCGGGCAACGCTACTTTTCGAATTTCTAATGTGAAACGCGTCTCCAACGCAACTGACGTGATCGCATTTCTCGGCTCGATCGAGCGTCTGGATCGCTGGAGCAATAAATACGTTGTACTCGACTCCACAACACAACTCGCTAAAGAAGCTCTAATTTTGCACGTGCGCGACGTAAGGCTCGGGCGCCGGAACTACCATTATTTTCTAAGCGGTCTGGTGATGGACGATCGCTGGGAAAGGGAGGTCACAGAATTCGGAGCTATTAACATAACTGGGTTTAGAGTACTGGATTTTTCGAGAAAAGTCGTAAGAGATTTTATCGATGTTTGGAAGAAGAATTCTATTTCGGCCCAAGCTGCCCTCATGTACGACGCGGTCCAGGTGTTGGTGGACGCCATAGTGCGGCTACTCCGTAAGAAGCCAGATATACTGAGGGGAACGATAAGACGGAATGCCAACGTGAACACAAGCCGCATCATCGACTGCAACCCTAAAGGCAAAATTACACCTTACGAACACGGCGACAAGATATCACGGATGATTAAAAAGACGGAGTTAGATGGGCTGACCGGAAGCCTTCGGTTCAACGAAGAGGGCCATCGTCGCAACTTTACCTTGCAAATCATGGAGCTCACTGTTGATGGTGAAATGGTCAAAATTGCGACGTGGTATGACAACCGCGGACTTGTGCCGGTGGTGCCCAAGCTATCACCATTGTCTCCCCCCGGAACATACGATCGAAACAAAACATACATAGTGTCCACCATAGAAGAGCCCCCATACGTTATGCGGCATAAAGCAGGCGGGCCGGAATCCACGCCTAACGACCCATACAGAGGCTTCTGTGTAGACCTCGCCAAAATGTTATCGGATAAGTTGGAAATCAAATATGACTTACGACTGGTGAAAGACGGAAAGTACGGAAACGACAATCCGAAAATAGTTGGCGGTTGGGACGGGATGGTTGGCGAACTCGTCAGGAAGGAAGTAGATATGGCTATAGCTCCACTCACGATCACACTAGAAAGAGAAACTGTTATTGACTTTAGCAAACCATTTTTGTCGTTCGATGTCAAAACGAAAAAAAATTCATTCAAGGACCCCACTACGATATTCAGTTTTCTTCATCCACTTTCTAAGGAAATATGGCTCTGCATTATATTCAGCTTGTTCGCCGTTAGTGTTGTACTATTTCTGGTATCGAGATTTTCCCCGCACGAATGGCGTTTGATTTCATTCACCGACTCTCAAACTTCGGATCACTCGGAAGTGGCAACAACAAAGACGACCGCGGTCAACGAATTCACCTTCTGGAATTCTATGTGGTTTTCGTTGGGTTCTTTTATGCAGCAGGGCAGCGACATTACGCCGAGATCGATTTCCGGAAGAATTGTAGGATCGGTTTGGTGGTTTTTCGCATTGATCGTTATCTCGTCGTACACTGCCAATTTGGCGTCTTACCTCACCCTGACACGTATATCGGAACCGAGTCAATCATACAACAAATTAGCGACATGCCCTGAGGATACGGCTGGCAATCTAGGAAATTCAATGTTCCAAGAAGGAGGTGAAGGGAATGGCTGGCTTAATTTTATCTTCGATCCTGCTGGTTCTAATAGCGAAAATGATAAAAAGCCCTGTGAAATGTTAGTCACCGTTGCCAGCACTGGGGTGCAGGATTTTGCAGTCGCAATGCCGAAGGGATCCAAATTGCGGGACGGAATCAACCTTGCCCTCCAATCACTTAAAAATGACGGCGAGTTGCAAAAACTCATCCGCAAATGGTTTACTAAAGCAGAGTGTGAAGCTAACCAGGACGTTCAAGGCTCGGAACTGACTTTAGGTCAAGTGGCGGGACTGTTCTACGTCTTGCTGGGTGGACTGGGTCTTGCTTTAGGCGTGGCATTATTGGAATTTTGTCAGCATGGTCGTGCTGAAGCAGCTCGCGCCAATGTCCCACTAGGGGCAGCGTTACGCGCCCGCGCTCAACTTGCTTCGTCTGGAACCAACCGTGACAGGAAGAACAATTCTCAGCGAACCCCACAACGTGATAGCGACCGACTCGGATGGAATGGCGGAGCCTTCACTGGAGTGAGCTACTACAGCCCGGCCACCCAGATCGGTCAGGAGGAGACTTCCCTGCACGCTAGCTTCACGCAAGTCTGA
Protein
MLTINIRRLIVREHVLHTCSIVCNQFGRGVMAMLGAVTPDSFDTLHSYSNTFQMPFVTPWFPEKVIPPSSGLIDYAVSMRPDYHRAVIDTITFYGWKNVIYVYDSHDGLLRLQQLYQSLQPGNATFRISNVKRVSNATDVIAFLGSIERLDRWSNKYVVLDSTTQLAKEALILHVRDVRLGRRNYHYFLSGLVMDDRWEREVTEFGAINITGFRVLDFSRKVVRDFIDVWKKNSISAQAALMYDAVQVLVDAIVRLLRKKPDILRGTIRRNANVNTSRIIDCNPKGKITPYEHGDKISRMIKKTELDGLTGSLRFNEEGHRRNFTLQIMELTVDGEMVKIATWYDNRGLVPVVPKLSPLSPPGTYDRNKTYIVSTIEEPPYVMRHKAGGPESTPNDPYRGFCVDLAKMLSDKLEIKYDLRLVKDGKYGNDNPKIVGGWDGMVGELVRKEVDMAIAPLTITLERETVIDFSKPFLSFDVKTKKNSFKDPTTIFSFLHPLSKEIWLCIIFSLFAVSVVLFLVSRFSPHEWRLISFTDSQTSDHSEVATTKTTAVNEFTFWNSMWFSLGSFMQQGSDITPRSISGRIVGSVWWFFALIVISSYTANLASYLTLTRISEPSQSYNKLATCPEDTAGNLGNSMFQEGGEGNGWLNFIFDPAGSNSENDKKPCEMLVTVASTGVQDFAVAMPKGSKLRDGINLALQSLKNDGELQKLIRKWFTKAECEANQDVQGSELTLGQVAGLFYVLLGGLGLALGVALLEFCQHGRAEAARANVPLGAALRARAQLASSGTNRDRKNNSQRTPQRDSDRLGWNGGAFTGVSYYSPATQIGQEETSLHASFTQV

Summary

Description
Receptor for glutamate. L-glutamate acts as an excitatory neurotransmitter at many synapses in the central nervous system. The postsynaptic actions of Glu are mediated by a variety of receptors that are named according to their selective agonists (By similarity). Forms ligand-gated ion channels which are activated by kainate.
Subunit
Homooligomer.
Similarity
Belongs to the glutamate-gated ion channel (TC 1.A.10.1) family.
Keywords
3D-structure   Alternative splicing   Cell junction   Cell membrane   Complete proteome   Glycoprotein   Ion channel   Ion transport   Ligand-gated ion channel   Membrane   Postsynaptic cell membrane   Receptor   Reference proteome   Signal   Synapse   Transmembrane   Transmembrane helix   Transport  
Feature
chain  Glutamate receptor 1
splice variant  In isoform 2.
EMBL
BABH01006903    BABH01006904    BABH01006905    GDKB01000027    JAP38469.1    KZ150215    + More
PZC72138.1    AGBW02013810    OWR42780.1    ODYU01003020    SOQ41261.1    KQ461108    KPJ09140.1    KQ459463    KPJ00605.1    KPJ09142.1    OWR42778.1    GDKB01000026    JAP38470.1    DS497669    EFA12935.1    KF768730    AIG51924.1    GEZM01016690    JAV91188.1    AAAB01008960    EAA11672.5    QOIP01000009    RLU18508.1    ADTU01014325    ADTU01014326    ADTU01014327    ADTU01014328    ADTU01014329    ADTU01014330    ADTU01014331    ADTU01014332    ADTU01014333    ADTU01014334    ACPB03000938    ACPB03000939    ACPB03000940    ACPB03000941    ACPB03000942    ACPB03000943    ACPB03000944    ACPB03000945    ACPB03000946    ACPB03000947    KQ981410    KYN41902.1    GBYB01005332    JAG75099.1    CVRI01000075    CRL08584.1    CH933809    EDW18397.1    CH940647    EDW69683.2    CH916366    EDV96485.1    CH902618    EDV41192.1    CH379070    KRT08845.1    CH954178    EDV51160.1    OUUW01000012    SPP87596.1    UFQT01000066    SSX19329.1    CH964062    EDW78721.1    EAL30350.1    CM000159    EDW93657.1    CM000363    CM002912    EDX09466.1    KMY97953.1    M97192    AE014296    BT003218    BT050435    KX016777    APF30026.1    CP012525    ALC43237.1    GL732605    EFX71861.1    GDIP01029649    JAM74066.1    GDIP01209509    JAJ13893.1    GDIP01180016    JAJ43386.1    GDIP01174566    JAJ48836.1    GDIQ01008113    JAN86624.1    KX016772    APF30021.1    GDIQ01241334    JAK10391.1    GBYB01011575    JAG81342.1    GDIP01146122    JAJ77280.1    GDIP01184715    JAJ38687.1    KQ982182    KYQ59168.1    GDIP01183366    JAJ40036.1    GDIP01163482    JAJ59920.1    GFXV01000473    MBW12278.1    KPJ00608.1    GDIP01197266    JAJ26136.1    GDIP01209510    JAJ13892.1    GDIQ01073743    GDIQ01052945    JAN20994.1    GDIQ01230429    JAK21296.1    GDIP01180017    JAJ43385.1    DS235817    EEB17589.1    GDIP01156921    JAJ66481.1    GDIP01174565    JAJ48837.1    GDIQ01021126    JAN73611.1    GDIQ01211392    JAK40333.1    GDIQ01152859    JAK98866.1    GDIP01222360    JAJ01042.1    GDIQ01076542    JAN18195.1    GDIQ01202352    JAK49373.1    GGMR01017110    MBY29729.1    GDIP01184716    JAJ38686.1    KQ436160    KOX67415.1    GDIP01183367    JAJ40035.1    CH477476    EAT40294.1    KQ414627    KOC67420.1    KQ434795    KZC05526.1    GL447910    EFN85705.1    GDIP01222361    JAJ01041.1    CH479217    EDW33705.1    KQ976514    KYM82208.1    KQ979440    KYN21485.1    HACA01001900    CDW19261.1    GDIP01138773    JAL64941.1    GL437123    EFN70991.1    GDIP01235911    JAI87490.1    KK107199    EZA55532.1    CAEY01001120    ALC43621.1    NWSH01007937    PCG62745.1    GL888365    EGI62137.1    UFQT01002179    SSX32863.1   
Pfam
PF00497   SBP_bac_3        + More
PF01094   ANF_receptor
PF00060   Lig_chan
PF10613   Lig_chan-Glu_bd
Interpro
IPR001828   ANF_lig-bd_rcpt        + More
IPR001638   Solute-binding_3/MltF_N       
IPR001320   Iontro_rcpt       
IPR019594   Glu/Gly-bd       
IPR028082   Peripla_BP_I       
IPR001508   Iono_rcpt_met       
SUPFAM
SSF53822   SSF53822       
PDB
5IDF     E-value=1.6099e-109,     Score=1016

Ontologies

Topology

Subcellular location
  
Cell membrane  
Cell junction  
Synapse  
Postsynaptic cell membrane  
Length:
841
Number of predicted TMHs:
3
Exp number of AAs in TMHs:
66.6874800000002
Exp number, first 60 AAs:
0.05845
Total prob of N-in:
0.00486
outside
1  -  501
TMhelix
502  -  524
inside
525  -  587
TMhelix
588  -  610
outside
611  -  736
TMhelix
737  -  759
inside
760  -  841
 
 

Population Genetic Test Statistics

Pi
3.985384
Theta
17.647859
Tajima's D
-2.007148
CLR
0.015592
CSRT
0.0126493675316234
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号