SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00231
Pre Gene Modal
BGIBMGA000567
Annotation
PREDICTED:_glutamate_receptor_1-like_[Bombyx_mori]
Full name
Glutamate receptor 1      
Alternative Name
Glutamate receptor I
Kainate-selective glutamate receptor
Location in the cell
PlasmaMembrane   Reliability : 2.958
 

Sequence

CDS
ATGCACAACCAAAATATAACCGGTCGAAGGTTCGAGCTGCAAGCATATGTGGACGTCATTAACACAGCCGATGCATTCAAGCTTTCACGACTCATATGCAACCAGTTCGCACGAGGCGTGTTCGCTATGCTTGGAGCTGTGACACCGGAATCCTTCGACACGCTGCATTCTTATACAAACACATTCCAAATGCCTTTCGTGACTCCGTGGTTCCCAGAAAAGGTAATTCCACCGTCATCTGGTTTGATTGATCACGCAGTGAGCATGAGACCAGACTATCACAGGGCTATTGTGGATACTATAATTTACTACGGATGGAAAGATATCATCTACATGTACGACTCGCACGATGGATTATTGAGGCTCCAGCAGCTGTACCAATCCATGCAGCCCGGCCGTACCGCGTTCCGAATCTCCCTTGTGAAGCGAATTAATAACGCGTCAGAAGCTTTGGAATTCCTGTTAACATTGGAACAACACGATCGCTGGGGCAACAAGCGCATTGTGCTTGATTGCAATGCGAAAAACGCCAAAAGCATATTAGTCGAGCACGTCCGAAAAGTTCAATTGGGGCGCAGGACATACCACTACATGCTCAGTGGACTAGTGATGGATGATCATTGGGAGAATGAGGTTACCGAGTACGGAGCAGTCAATATTACGGGGTTCCGCATCGTTGACCACTCTAGGAAGATTGTTCGCGATTTCATGGAAGGTTTGCGAAGAATGGACCCCCGGTTCAAGGGGACTATATCGGCAAAAACAGCGCTTATGTACGACGGTGTCCAGGTATTAATGGATGCGCTTAGTAGACTCTGGCGGAAGAAACCGGATGCATTCAGGAATGCACTGCGTCGGGCCGCAGCTGGTCAAATGAACACAACTAAAGTAATTGACTGTAATCCTGGGAAAAACTGGGTGGTGCCTTTCGAGCATGGAGACAAAATCTCAAGGCTGATAAAAAAGACGGACATCGAAGGTCTGACCGGAAATATATCTTTTAATGAGGAAGGTCATCGGTACAATTTCACATTAAATGTCGTTGAGATGACAGTTCAAAGTGCTATGCTGAAGGTAGCAACGTGGTCGGACGTCCGTGGTTTACAGCTTGTCTCGCAGAAACACGTTCAGTTAAAATCACCGGCGTCGTATGACATAAATAGAACGTATATTGTGACAACGGTGCTACAGGAGCCTTACCTAATGCCTAAGCCGTTTGAATTCGGACAGAAAGAGGAACAATTCCACGGATTTTGCAAGGACCTTGCCGATTTAGTGGCGAAAAGACTAGGAATTAAATATGAATTAAGAATAACGAAAGACAATAGAAAAACTGAGGAATTGTTTTCAGAAGGTTCTTCCAGATTAGTCGACGATATAGTCAGAAAGGATGCGGATATAGCAGTGGCTCCTCTGGCTGTGACCCCTGAAAGGGAGCGAGTCTTGGATTTCAGCGAGCCGTTTCTCTCTGTCGATGTCCCGATAACTCACAAGAAACTGCAAAAGCAACTGAAGGATACCTTCAGCTTCCTGAAGCCACTCTCAAAGGAGATATGGCTATGTGTTTTATTTAGTTTTTTTGCTGTGAGCATCGTTCTTTTCTTGGTCTCAAGATTCTCTCCGCGTGAATGGCGATCGATTTCCATATCCGACACACATTTGGATCATCCGATAAGCAGCACGAATGAGATTATACTTCATAATGAATTTAGTATTTGGAATTCGTTCTGGTTTTCTCTCGGCTCTTTTATGCAGCAAGGAAGCGACGTTGTTCCCAAGTCGTTATCTGGAAGAATAGTAGGCACGGTTTGGTGGTTCTTCGCACTTATTCTAGTATGTTCGTACACTGCTAATCTTGCTGCCTATCTAATAGTGGAACGTATAGCAGCGCCAATGCAGTCAATCAGCTATACATCGACCCTGCCGAATATCGAAAATACGCAATTCCCAAGAATTAGTCTGGTAAAAGAACAAAATCCTTATGCTGAAGCTGTCCCTAGCTATGTCTCTAATCGTGAAGGTCAATTCTCCTGCGACACTCCACGCGTCTGCCGATATAAGCATGTATATTACAGTATAGCCACCGCAAAAGGATCGGCACTCAGGGAAGCCATAAACATTGCAATTGTTAATCTGAGGAAGGAAGGTCTATTGACTAAATTGTGGAATAAATGGATTTCAAAAATGAAAAAGCCTGACTGTGATATTGGCAATGATGAGGAATCGTCAATAACGGAGATGACCTTGAGTCAAGTCGCTGGAATATTTTACGTGCTTCTTGGCGGATTGGCTTTGGCTTTAGGTATTGCATTACTGGAATTCTGTCAGCATGGACGAGCTGAAGCTACCCGCGCCAATGTGCCGTTAAGGGCTGCTTTACGTGCGAGAGCAAAATTCGCTTCATCCACAAGGGAACGTAAGACTCCTCCGCAGCGAACGCCACAACGCGACCGCGACCGTCTTGGTTGGAACGGGGCAGCCTTCGCAGGGGTCAGTAAGTACAATGACTTCCTCCTAGGAAGAGAATTGTTGGGACATGCTCACCGAAAAATGTATTAA
Protein
MHNQNITGRRFELQAYVDVINTADAFKLSRLICNQFARGVFAMLGAVTPESFDTLHSYTNTFQMPFVTPWFPEKVIPPSSGLIDHAVSMRPDYHRAIVDTIIYYGWKDIIYMYDSHDGLLRLQQLYQSMQPGRTAFRISLVKRINNASEALEFLLTLEQHDRWGNKRIVLDCNAKNAKSILVEHVRKVQLGRRTYHYMLSGLVMDDHWENEVTEYGAVNITGFRIVDHSRKIVRDFMEGLRRMDPRFKGTISAKTALMYDGVQVLMDALSRLWRKKPDAFRNALRRAAAGQMNTTKVIDCNPGKNWVVPFEHGDKISRLIKKTDIEGLTGNISFNEEGHRYNFTLNVVEMTVQSAMLKVATWSDVRGLQLVSQKHVQLKSPASYDINRTYIVTTVLQEPYLMPKPFEFGQKEEQFHGFCKDLADLVAKRLGIKYELRITKDNRKTEELFSEGSSRLVDDIVRKDADIAVAPLAVTPERERVLDFSEPFLSVDVPITHKKLQKQLKDTFSFLKPLSKEIWLCVLFSFFAVSIVLFLVSRFSPREWRSISISDTHLDHPISSTNEIILHNEFSIWNSFWFSLGSFMQQGSDVVPKSLSGRIVGTVWWFFALILVCSYTANLAAYLIVERIAAPMQSISYTSTLPNIENTQFPRISLVKEQNPYAEAVPSYVSNREGQFSCDTPRVCRYKHVYYSIATAKGSALREAINIAIVNLRKEGLLTKLWNKWISKMKKPDCDIGNDEESSITEMTLSQVAGIFYVLLGGLALALGIALLEFCQHGRAEATRANVPLRAALRARAKFASSTRERKTPPQRTPQRDRDRLGWNGAAFAGVSKYNDFLLGRELLGHAHRKMY

Summary

Description
Receptor for glutamate. L-glutamate acts as an excitatory neurotransmitter at many synapses in the central nervous system. The postsynaptic actions of Glu are mediated by a variety of receptors that are named according to their selective agonists (By similarity). Forms ligand-gated ion channels which are activated by kainate.
Subunit
Homooligomer.
Similarity
Belongs to the glutamate-gated ion channel (TC 1.A.10.1) family.
Keywords
3D-structure   Alternative splicing   Cell junction   Cell membrane   Complete proteome   Glycoprotein   Ion channel   Ion transport   Ligand-gated ion channel   Membrane   Postsynaptic cell membrane   Receptor   Reference proteome   Signal   Synapse   Transmembrane   Transmembrane helix   Transport  
Feature
chain  Glutamate receptor 1
splice variant  In isoform 2.
EMBL
KQ461108    KPJ09142.1    GDKB01000026    JAP38470.1    AGBW02013810    OWR42778.1    + More
KF768730    AIG51924.1    KQ459463    KPJ00608.1    NWSH01007937    PCG62745.1    DS497669    EFA12935.1    JTDY01001828    KOB72773.1    GEZM01016690    JAV91188.1    QOIP01000009    RLU18508.1    AAAB01008960    EAA11672.5    ADTU01014325    ADTU01014326    ADTU01014327    ADTU01014328    ADTU01014329    ADTU01014330    ADTU01014331    ADTU01014332    ADTU01014333    ADTU01014334    GDKB01000027    JAP38469.1    KQ981410    KYN41902.1    GBYB01005332    JAG75099.1    CH964168    EDW80126.2    CVRI01000075    CRL08584.1    KZ150215    PZC72138.1    ODYU01009720    SOQ54346.1    UFQT01000066    SSX19329.1    CM000159    EDW93657.1    ACPB03000938    ACPB03000939    ACPB03000940    ACPB03000941    ACPB03000942    ACPB03000943    ACPB03000944    ACPB03000945    ACPB03000946    ACPB03000947    CH902618    EDV41192.1    CH379070    EAL30350.1    KRT08845.1    CH954178    EDV51160.1    CH940647    EDW69683.2    CH964062    EDW78721.1    CH916366    EDV96485.1    M97192    AE014296    BT003218    BT050435    OUUW01000012    SPP87596.1    CM000363    CM002912    EDX09466.1    KMY97953.1    CH933809    EDW18397.1    OWR42780.1    GL732605    EFX71861.1    CP012525    ALC43237.1    GDIP01029649    JAM74066.1    GDIP01209509    JAJ13893.1    GDIQ01008113    JAN86624.1    GDIP01180016    JAJ43386.1    GDIP01174566    JAJ48836.1    KX016772    APF30021.1    GDIQ01241334    JAK10391.1    KX016777    APF30026.1    GDIP01146122    JAJ77280.1    GDIP01183366    JAJ40036.1    GDIP01209510    JAJ13892.1    GDIP01184715    JAJ38687.1    GDIP01197266    JAJ26136.1    GDIQ01073743    GDIQ01052945    JAN20994.1    GDIP01180017    JAJ43385.1    GDIQ01230429    JAK21296.1    EDV41125.2    GDIQ01021126    JAN73611.1    GDIQ01211392    JAK40333.1    GDIP01174565    JAJ48837.1    GFXV01000473    MBW12278.1    GDIQ01152859    JAK98866.1    EDW17465.2    ALI30468.1    CH480815    EDW40824.1    EDX09816.1    KMY98577.1    AGB94316.2    GDIQ01076542    JAN18195.1    BT150463    AAF50306.2    AGB94317.1    AJP62085.1    AJ251886    AJ251887    CAB64939.1    CAB64940.1    EDV50574.2    CH379068    EDY73342.2    GDIP01163482    JAJ59920.1    GGMS01017908    MBY87111.1    GDIQ01202352    JAK49373.1    GDIP01222360    JAJ01042.1    KQ982182    KYQ59168.1    GDIP01156921    JAJ66481.1    GBYB01011575    JAG81342.1    BABH01006903    BABH01006904    BABH01006905    CH479217    EDW33705.1    GDIP01183367    JAJ40035.1    GDIP01184716    JAJ38686.1    ODYU01003020    SOQ41261.1    DS235817    EEB17589.1    GDIP01222361    JAJ01041.1    GGMR01017110    MBY29729.1    HACA01001900    CDW19261.1    GDIP01138773    JAL64941.1    KQ436160    KOX67415.1    KQ434795    KZC05526.1    KQ414627    KOC67420.1   
Pfam
PF10613   Lig_chan-Glu_bd        + More
PF00060   Lig_chan
PF01094   ANF_receptor
PF00497   SBP_bac_3
Interpro
IPR001508   Iono_rcpt_met        + More
IPR028082   Peripla_BP_I       
IPR019594   Glu/Gly-bd       
IPR001320   Iontro_rcpt       
IPR001828   ANF_lig-bd_rcpt       
IPR001638   Solute-binding_3/MltF_N       
SUPFAM
SSF53822   SSF53822       
PDB
5IDF     E-value=2.01799e-130,     Score=1196

Ontologies

Topology

Subcellular location
  
Cell membrane  
Cell junction  
Synapse  
Postsynaptic cell membrane  
Length:
852
Number of predicted TMHs:
3
Exp number of AAs in TMHs:
67.9445300000001
Exp number, first 60 AAs:
0.38246
Total prob of N-in:
0.03251
outside
1  -  517
TMhelix
518  -  537
inside
538  -  602
TMhelix
603  -  625
outside
626  -  751
TMhelix
752  -  774
inside
775  -  852
 
 

Population Genetic Test Statistics

Pi
26.125452
Theta
21.878473
Tajima's D
-1.478147
CLR
0.046898
CSRT
0.0610969451527424
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号