SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00229
Pre Gene Modal
BGIBMGA000643
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_UDP-N-acetylglucosamine--peptide_N-acetylglucosaminyltransferase_110_kDa_subunit-like_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.336 PlasmaMembrane   Reliability : 1.02
 

Sequence

CDS
ATGGATTATCAATGCATCGTCGTCTACACCGTCATCAATATCGCTCCACCGCGTCTTACAGCTCAAGCCTCCGAATTCTCAAACGGCTGTGTCACCTGGTTCAAGAATAAAATTAAAAAAGCTCTTGCAGTGTATCTTCATTCTCTGAAATTAAATCCAAGCAACGGAATCGTGCACGGTAACTTAGCGTGTCTCTATTACAAACAAGGCTTCATAGACCTAGCCATCGATACATACAAGCGCGCTATAGAACTACAGCCTGACTTTCCGGACGCGTACTGCAATCTAGCTAATGCACTCAAAGAGAAGGGCCTTGTGACCGAAGCAGAGGAGTGCTATTTCAAAGCACTAAGTCTATGTCCCACACATGTAGATACACTCAATAATCTTGGCAACGTCAAAAGGGAACAAGGGAAAATTGATGAAGCTACAAATTTATACATGAAAGCCTTGGAGGTGTTCCCTAATTTTGCGGCAACTCATAGCAATTTGGCATCCCTTTTACAGCAACAAGGTAAACTACATCAAGCTCTATTTCACTATAAACAGGCTATCGGTATACAACCTAAGTTCGCAGATGCTTACAGTAATATGGGTAACACTCTTAGAGAGCTGCAAGACATGACGGGAGCACTTGCATGTTTCAAAAAAGCTATTGAAATAAATCCTACATTTTCTGATGCACATTGTAATTTAGCCAGCATTTACAAAGATACTGGCAACATCAAAGAAGCTATTGAGTCATACAAAAACGCTCTGTATTTTAAACCTGATTTTCCCGATGCTTATTGCAATTTAGCGCACTGTTTACAAATTGTTTGCAACTGGGATGACTACTACGAACGAATGCATAATATTATAGAAATAGTCAATAAACAATTAAAAATGGATAAACTTTCTTCTGTGCATCCACACCATTCCATCTTATATCCACTTACGAATGAAGCCAGGCGAGAAATTGCCACTCGACATGCAAATTTGTATATAGACAAACTTCATTTTTTGCAAAATACTGTCACGTTTCAACACCCCAAAGTTATGGAAGGTCGATTACGAATTGGTTACGTAAGCAGTGATTTCGGTAATCATCCAACCTCACATTTAATGCAGTCCATTCCGGGTAGCCATGATCGTTCCAAAGTGGAAGTTTTTTGTTATGCACTCAACGCTGATGATGGTACAACATTCCGTAGAAAAATAGTTGAAGAATCTGAAAATTTTATCGATTTATCTTGTATCCCTTGCAATATGGAAGCGGCTACAAGAATCCACAGAGATGGTATCCATATCTTAATTAACATGAACGGTTATACAAAGGGAGCTAGAAACGAAATTTTTGCTTTAAAACCAGCGCCTATTCAGGTTATGTGGTTGGGATATCCGGGGACAAGTGGAGCGGGCTACATAGATTATATGATAACTGATGAAGTTTCCGCACCTTTGTCGTTATCAGAAGATTTTAGTGAAAAATTTGCATATATGCCGCATACTTATTTTGTTGGTGATCACAAAAAAATGTTTCCTCACTTAAAAACGAAGTACAAGGTACTGATTGATAATAATTCGATAGCTCATGAAAATGTAGCACTGATTAATTCGTCTGAATTTATTAATATTGATGAAGTTTTTAATGTAAGATGTGATAAGACAATTGTATCCTTCGAAAATCTCGAAGAAATTGAATTTATTATAAGAAAAGTAAACATTCCGAATTATGTACTCGATACGACAATTAATCCTAAGCAAGAAAAGGTCTTAGTCAACGGTACTGTCATTGATAATGGTATATCAATAAATTATTCCAGTAAGAGAGTTGCATCCGGTGAAGTTTCTTTTGAAAATATTGTTTTTACGTCCAGAAAGCAGTACGGCTTACCTGAAGATGCAGTTGTTTTTTGCAATTTCAATCAGCTATACAAAATTGATCCAAGAATAATGGAATCTTGGGTAACTATTCTGAAACTGGTCCCTAATAGCGTACTGTGGTTGTTAAGTTTTCCTGCTGCTGGAGAACCTAATATTCAGAAATATGGGCTAAATTTAGGTTTAACACCAGGACGTATTATTTTCTCTAAAATTGCTTGTAAAGAAGAACACGTAAGACGTGGACAGTTAGCAGACATCTGCTTAGATACACCACTTTGCAACGGCCACACAACGACGATGGACATCCTCTGGACTGGCACTCCAGTGGTTACTCTGCCCGGAGATACGCTCGCTTCAAGAGTTGCTGCATCCCAGCTAACAGCACTTCATTGTACGGAGCTCATTGCTAAAAATAGAAAGCATTACGAAGATATAGCCATCAAATTAGGAACTGATTCTGCATACCGGCGATATATTCGTGCGAAAGTTTCGAAAGCTCGTTTAGAAAGCACGTTGTTTGACTGCGAGCATTATGCAAGAGGCTTGGAGAGCCTTTACTCTAAAATGTGGGAACTATATCAAAGAGGAGACAAGCCTGATCACATCGCTGTTTCTTCGAAGTGA
Protein
MDYQCIVVYTVINIAPPRLTAQASEFSNGCVTWFKNKIKKALAVYLHSLKLNPSNGIVHGNLACLYYKQGFIDLAIDTYKRAIELQPDFPDAYCNLANALKEKGLVTEAEECYFKALSLCPTHVDTLNNLGNVKREQGKIDEATNLYMKALEVFPNFAATHSNLASLLQQQGKLHQALFHYKQAIGIQPKFADAYSNMGNTLRELQDMTGALACFKKAIEINPTFSDAHCNLASIYKDTGNIKEAIESYKNALYFKPDFPDAYCNLAHCLQIVCNWDDYYERMHNIIEIVNKQLKMDKLSSVHPHHSILYPLTNEARREIATRHANLYIDKLHFLQNTVTFQHPKVMEGRLRIGYVSSDFGNHPTSHLMQSIPGSHDRSKVEVFCYALNADDGTTFRRKIVEESENFIDLSCIPCNMEAATRIHRDGIHILINMNGYTKGARNEIFALKPAPIQVMWLGYPGTSGAGYIDYMITDEVSAPLSLSEDFSEKFAYMPHTYFVGDHKKMFPHLKTKYKVLIDNNSIAHENVALINSSEFINIDEVFNVRCDKTIVSFENLEEIEFIIRKVNIPNYVLDTTINPKQEKVLVNGTVIDNGISINYSSKRVASGEVSFENIVFTSRKQYGLPEDAVVFCNFNQLYKIDPRIMESWVTILKLVPNSVLWLLSFPAAGEPNIQKYGLNLGLTPGRIIFSKIACKEEHVRRGQLADICLDTPLCNGHTTTMDILWTGTPVVTLPGDTLASRVAASQLTALHCTELIAKNRKHYEDIAIKLGTDSAYRRYIRAKVSKARLESTLFDCEHYARGLESLYSKMWELYQRGDKPDHIAVSSK

Summary

EMBL
ODYU01002299    SOQ39611.1    KZ149977    PZC75885.1    NWSH01001075    PCG72736.1    + More
AGBW02013810    OWR42776.1    KQ461108    KPJ09145.1    KQ980322    KYN16575.1    ATLV01011337    KE524664    KFB36021.1    AXCM01003360    DS231886    EDS43349.1    NNAY01002903    OXU20353.1    ADMH02000262    ETN67206.1    APCN01000030    NEVH01021207    PNF19894.1    GBRD01010100    GBRD01004885    GBRD01004884    JAG60936.1    GECU01025096    JAS82610.1    KQ978023    KYM98017.1    KQ982624    KYQ53682.1    GEDC01030693    GEDC01027732    JAS06605.1    JAS09566.1    KQ981948    KYN32648.1    KQ976723    KYM76681.1    ADTU01025121    GL887898    EGI69572.1    ODYU01002802    SOQ40748.1    KQ414758    KOC61571.1    KZ288255    PBC30698.1    NWSH01000423    PCG76494.1    JR036952    AEY57498.1    JR036953    AEY57499.1    KK107078    EZA60211.1    QOIP01000011    RLU16638.1    CH478429    EAT32999.1    KQ760514    OAD60022.1    PYGN01000467    PSN45840.1    KQ435724    KOX78410.1    BABH01019450    KQ460473    KPJ14407.1    GDKW01000423    JAI56172.1    AXCN02000346    KQ971331    EFA01003.1    GGFL01004463    MBW68641.1    GGFK01002651    MBW35972.1    GGFJ01001095    MBW50236.1    KYB28293.1    GGFL01005015    MBW69193.1    GGFK01002408    MBW35729.1    GGFJ01001195    MBW50336.1    KQ459597    KPI94754.1    GGFJ01001238    MBW50379.1    AGBW02012603    OWR44731.1    GGFK01003023    MBW36344.1    GFDL01003711    JAV31334.1    GBBI01002194    JAC16518.1    GGFM01000894    MBW21645.1    GGFJ01001956    MBW51097.1    GECL01003455    JAP02669.1    GGFJ01001960    MBW51101.1    AAAB01008960    EAA10760.4    LJIG01016195    KRT81330.1    GL441834    EFN64211.1    DS235873    EEB19625.1    GDIP01236217    JAI87184.1    GBGD01000245    JAC88644.1    GDIQ01221585    GDIQ01142216    GDIQ01142215    GDIQ01125129    GDIQ01113418    GDIQ01096321    GDIP01055887    GDIQ01082945    JAL26597.1    JAM47828.1    GDIP01234374    JAI89027.1    GFDF01001462    JAV12622.1    AF217788    AE013599    BT032865    AAF32311.1    AAF57338.1    AAG22338.1    AAG22339.1    ACD81879.1    GBHO01003282    GDHC01006945    JAG40322.1    JAQ11684.1    GBHO01027602    JAG16002.1    GEZM01013689    GEZM01013687    JAV92369.1    GECU01006701    JAT01006.1    CM002911    KMY91610.1    KMY91611.1    GAMC01012750    JAB93805.1    JXUM01071183    JXUM01071184    KQ562648    KXJ75410.1    GFDF01001473    JAV12611.1    GDIQ01041005    JAN53732.1    GEZM01013688    JAV92370.1    GFDF01001494    JAV12590.1    CH954177    KQS71055.1    GDIQ01140365    JAL11361.1    CM002912    KMZ01359.1    OUUW01000032    SPP89814.1    UFQT01001415    SSX30450.1    CH479296    EDW25761.1    CH940648    EDW61182.1    KRF79836.1    KRF79837.1    CH891608    KRK05133.1   
Pfam
PF13844   Glyco_transf_41        + More
PF00515   TPR_1
PF13181   TPR_8
PF09177   Syntaxin-6_N
Interpro
IPR013026   TPR-contain_dom        + More
IPR037919   OGT       
IPR011990   TPR-like_helical_dom_sf       
IPR019734   TPR_repeat       
IPR029489   OGT/SEC/SPY_C       
IPR001440   TPR_1       
IPR015260   Syntaxin-6_N       
IPR010989   SNARE       
IPR003107   HAT       
SUPFAM
SSF48452   SSF48452        + More
SSF47661   SSF47661       
Gene 3D
PDB
5A01     E-value=0,     Score=2477

Ontologies

Topology

Length:
829
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.137580000000001
Exp number, first 60 AAs:
0.0912900000000001
Total prob of N-in:
0.00542
outside
1  -  829
 
 

Population Genetic Test Statistics

Pi
21.283792
Theta
22.940449
Tajima's D
0.044781
CLR
0.008134
CSRT
0.387780610969452
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号