SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00183
Annotation
gag-like_protein_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.406
 

Sequence

CDS
ATGGAAGAAAGTGCAAGTGTTTGTGACAGTGATCTTGTCGGGTTCCTCCGGGATAGGTACCCGTCAATTAGGGCCGAATATTTAGCATTTAGGGCCTCTCGTGGCAATCCCTCCCCCCCCGCGTCCGTCGCCGCGTATTTCAACCGTGCCTCGGAGGCACGCCGCGCGCCCCCCGCCGCGTTAAGTTCGAGCGCACGTTCCGACGATGCGACTCACGAAGCGCCTAGCGCTACCCCCACCCCCGCGCCCGCGTCGATTACGTCATCGCTCGTATCGTCCGTCGCGACCTCGATTGTTTCGAGTTCAGGCTCCGATACCGAATCGGAGATGGATTTCGAATCCGCGTCAAGCCCTCAGCCTGGAACTTCGGATGGGTTCCAAACCGTAACGCGCGGTAAAAAGCGTACTCGCGCCGTGGAGTCCCGGAGCTCCACGACGAAGCAGACAAAATCCGCGACCGCCTCCCGCCCGCAGGTAGTCGTGACACCGGAGTCGGACTCCGCTCGCCGCGTAACCCCGCCGCCGCGTCCCAAGCCCGCGCCCGCTCCTAAAGCAGCTGCCCCGCCCCCGCTGATTCTCCAGGAAAAAACTGCGTGGAACCGCGTTTCCCAGGCCCTTCAGGCAAATAAAATTAATTATACCCATGCGCGTAACGTCGCGCATGGGATTCAGATAAAGGTCGCAACGCCGGGCGACCATAGGGCCCTCTCAGCATACCTCCGAAAGGAGAACATAGGTTTCCACACCTATGCTCTTCAGGAGGACCGCGAGCTCCGCGTAGTGATACGCGGAGTCCCTAAAGAACTCGACATCGACTACATAAAGGAGGATCTGACCGCTCAGGCCCTCCCGATAGTTAGTGTGCACCGGATGCACAGCGGGCGGGGCAAACAGCCCTATAATATGATACTCGTGGCGTTAGAACCCACCCCGGAGGCCAAAAAGAAGATCGCATGTCTCACGACAATTTGCGGCCTATCCGGGATCTCAATCGAAGCCCCCCACAAGCGTGGCACTCCCGGGCAGTGCTACAGATGTCAGCTTTACGGCCACTCGGCTCGTAATTGCCACGCGCGCCCCCGCTGCGTAAAGTGCCTCGGCGACCACGCCACACTAGATTGCTCGCGTGTTAGGGAAACCGCGACCGAACCCCCAAGTTGTGTCCTATGCCTTAAGCAAGGGCACCCCGCGAACTACCGTGGATGTCCTAGGGCTCCGCGCAAGCGTTCAACCCTCCCAGCTCCGCGAACCGTCGGCCCAAAGACTTCGGCACCCTCAGTGCCGAAACCTGCCTTCGTGCCGGCTGCAGTTCCCACGGTTTCAGCGTGGAAAAAGCCGCTGCCGTATACGAAGGCGGGAACACAAACCGCACCCCCGCCCCCGCTCGCGACACGCCCCGCGCCTCAGCCCCTGCTCGCACCTCGCCCCGCGCCCGCGTTCCGTCCCCCGCAACCCTCTGCCGCCAACGACTTCGCGCTCGTGCGCGACTTCGTCACCGCGGTGAACTTCGACCGTCTGCGATCGTTCGCTGACGCTATCCGTAGGTCGACAACCCCCGAACAGCGGCTCGCGGCCGCGTTCGATCACATGGACGTTTATGAGTCCGTGTCGCGTACGTTATAA
Protein
MEESASVCDSDLVGFLRDRYPSIRAEYLAFRASRGNPSPPASVAAYFNRASEARRAPPAALSSSARSDDATHEAPSATPTPAPASITSSLVSSVATSIVSSSGSDTESEMDFESASSPQPGTSDGFQTVTRGKKRTRAVESRSSTTKQTKSATASRPQVVVTPESDSARRVTPPPRPKPAPAPKAAAPPPLILQEKTAWNRVSQALQANKINYTHARNVAHGIQIKVATPGDHRALSAYLRKENIGFHTYALQEDRELRVVIRGVPKELDIDYIKEDLTAQALPIVSVHRMHSGRGKQPYNMILVALEPTPEAKKKIACLTTICGLSGISIEAPHKRGTPGQCYRCQLYGHSARNCHARPRCVKCLGDHATLDCSRVRETATEPPSCVLCLKQGHPANYRGCPRAPRKRSTLPAPRTVGPKTSAPSVPKPAFVPAAVPTVSAWKKPLPYTKAGTQTAPPPPLATRPAPQPLLAPRPAPAFRPPQPSAANDFALVRDFVTAVNFDRLRSFADAIRRSTTPEQRLAAAFDHMDVYESVSRTL

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
540
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0004
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00129
outside
1  -  540
 
 

Population Genetic Test Statistics

Pi
15.257319
Theta
22.32045
Tajima's D
-1.362906
CLR
0
CSRT
0.0767461626918654
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号