SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00173
Pre Gene Modal
BGIBMGA011112
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.204
 

Sequence

CDS
ATGGGTGAAAGAATTATTTCTCAACCGGACTTCCTCCTATACCATATTGGAACGACGCCAGGACACCATGGCGTTGGTTTCATCGTCAAAAAATATCTTGAAAAATCTGTAGAAGAATTTATAGGAATCTCGGAGCGCATAGCAATGATGAATTTAAAGTTACCGGGATATAATGATGCATGGTCTATTGTACAAATATATTCTCCAACAGAACAATCGGACCTGGAAACAATTGAGGAATTCTACCTTGACTTAAATAACACTATCCAAGAACGTGCCCACAAAAACTTAATCGTCATGGGAGATTTCAATGGCCAAATTGGAGCTAAGCGTCCAGGAGAAGAGACCGTACTGGGATCATTCACTTACAGTAACAAAATTAGAAGTAGAAATGGAGAAAAACTTATAAATTTCACACTAGAAAATAACTTAACCATTTTAAACTCAGTATACAAAAAAAACACAACGAAAATGTGGACATGGATTTCACCAGATGGAAAAACCAAGAACGAAATAGATTTTATAATGACCAATACAAAGAAATGCTTTACAAATTTCGACGTCATTAATAAATTTAACTTCAATACGAATCATAAACTAATTAGAGCTGAAATAAAATCAGTACAACCAAAGAAACCTAGACCGAGACAGGAACTAACAATCGGTAAGCTCAGCAAGCACCAAATGGCGCAACTCGTGGCCAACCTAAGAGATAAATTCATAGACTTCAAAAAGAACACAAATACCATGGGAACCCAAGAAAAATACAACTGGATAGAGAATATTATTAACGATCAAGTACAACACATTGACAAGATTAGATCTGAACCGAGAAAATGGCTAACATCTAATACCATGAAATTACTAGAGCAAAGAAACCAGCTAATCAGCGCAAAAGAAGGAAAAGACAGAAGAAGGCATTTAGCGAAAATTAGTAAAGACATCAAAGAAAGTATAAGGACGGACAGGAAAAAGAGTAGAATGGAAATTATTGAAAAGCATATAGCCAAAACGGGAGGCATTAAAAAAGCTCATAGAGAATTAACAAATTCAAATGACTGGATCGCAAAAATTAAAAACAACAGCGGAGAATGGCACCATAATAGAACTAATATATTAGGAATCGCTACGTCCTACTACAAAAAAATCTATGAACACAACACCGCTCAGGACAATATATACCTAGCGGAAACCTCAAGTATCCCTAACATCATTCAAACTGAAGTAACAAAAGCTATAGATAGTCAACACAGAGACAAAGCACCAGGACCCGATGGCATAAGCAACGAAATCTTAAAAGAAAGTAATGAAATTATAACACCAGTTCTCACTGAGATGTTTAATGAGATATTAAAAACCGAAATTATCCCACGGCAATGGACAGAATCAAATATTTTACTTCTATATAAGAAAGGAGACAAATATGACATTGGGAACTACCGCCCTATTAGCCTTATGTCCAACATATACAAGGTATTCGCCAAGGTCATACTTAATCGGATTGAAAAAATATTAGACGAACACCAACCCATCGAGCAAGCGGGATTTCGTAAAGGCTATTCAACGATCGACCACATTCATGTAGTACGCCAAGTAATGGAGAAGTATAAAGAACACCAATGCACCTACTATATCGCATTTATTGATTATAGCAAAGCATTCGATTCTTTGTTTCATGAAAAGGTATGGGAGTCATTAAAAGAACAAGGAATTGAACACAAATACATCCGGTTAATAAAAAATGTTTACAGCCAGAGTACTGCGAGAATACAATTAGAAAAGAAAGGTGAACCTTTCAGAGTAGGCAAAGGTGTACGACAAGGAGATCCCCTGTCACCAAAAATATTCTCGGCGGTACTAGAATCCATATTCAGAGCTCTAAATTGGGAAAATCTCGGTATCAATGTAGACGGTGTCTCATTGACTCACTTGAGATTCGCAGATGATATTGTGTTATTTGCAAAATCCTCGGAAGACATCACAAGAATGATAAACGAATTATCAACGGAGAGCGAGAAGGTAGGGTTAAAACTGAACCTGGAAAAAACAAAAATAATGACAAACGGAGAGAGAATTCCCACAAACTTAGGAAACAACCAAATTGATTACACCGATGAATATATTTACTTGGGACAGCTAATAACAGATGATAATCCGGTGCTCAAAGAAGTTGAAAGAAGAATAACTAATGGCTGGAGAAGGTACTGGGGCTTGAAAGAAATTATGAAGGACAAAAATCTTCATATGAACATTAAAAGCAAACTATTTAATACTTGCATACTACCAGTTCTCATGTACGGCAGTCAAACATGGGCTTTATCACAAAACACGATTAGCAAGCTTGCATCATGCCAACGCGCAATGGAGAGGAGCATGATGAACGTGAAAAAGTCAGACCGACTGAGTAACCGTATAATAAGAAGCAAAACAAAGGTAATAGATATAGGGTGCAAAATTAGAAGGCTTAAATGGCGTTGGGCAGGGCATATGGTTAGAGGTAAAGATAAATGGAGCAAAGTTGTGACACAATGGTATCCTAGAGAAAGTAAAAGGAAAAAAGGTAGACCGCAAAAAAGATGGGATGACGACATACGACAAGTGGCAGGCGTCACATGGAACAGAGTGGCTCAAGAAAGACATGAGTGGAAAAGGTTGGAGGAGGCCTTTGTCGATTGGCAAACAGATCTGCAGAAAATAAGAAAAATACAAATAATAGGCTAG
Protein
MGERIISQPDFLLYHIGTTPGHHGVGFIVKKYLEKSVEEFIGISERIAMMNLKLPGYNDAWSIVQIYSPTEQSDLETIEEFYLDLNNTIQERAHKNLIVMGDFNGQIGAKRPGEETVLGSFTYSNKIRSRNGEKLINFTLENNLTILNSVYKKNTTKMWTWISPDGKTKNEIDFIMTNTKKCFTNFDVINKFNFNTNHKLIRAEIKSVQPKKPRPRQELTIGKLSKHQMAQLVANLRDKFIDFKKNTNTMGTQEKYNWIENIINDQVQHIDKIRSEPRKWLTSNTMKLLEQRNQLISAKEGKDRRRHLAKISKDIKESIRTDRKKSRMEIIEKHIAKTGGIKKAHRELTNSNDWIAKIKNNSGEWHHNRTNILGIATSYYKKIYEHNTAQDNIYLAETSSIPNIIQTEVTKAIDSQHRDKAPGPDGISNEILKESNEIITPVLTEMFNEILKTEIIPRQWTESNILLLYKKGDKYDIGNYRPISLMSNIYKVFAKVILNRIEKILDEHQPIEQAGFRKGYSTIDHIHVVRQVMEKYKEHQCTYYIAFIDYSKAFDSLFHEKVWESLKEQGIEHKYIRLIKNVYSQSTARIQLEKKGEPFRVGKGVRQGDPLSPKIFSAVLESIFRALNWENLGINVDGVSLTHLRFADDIVLFAKSSEDITRMINELSTESEKVGLKLNLEKTKIMTNGERIPTNLGNNQIDYTDEYIYLGQLITDDNPVLKEVERRITNGWRRYWGLKEIMKDKNLHMNIKSKLFNTCILPVLMYGSQTWALSQNTISKLASCQRAMERSMMNVKKSDRLSNRIIRSKTKVIDIGCKIRRLKWRWAGHMVRGKDKWSKVVTQWYPRESKRKKGRPQKRWDDDIRQVAGVTWNRVAQERHEWKRLEEAFVDWQTDLQKIRKIQIIG

Summary

EMBL
FJ265564    ADI61832.1    FJ265561    ADI61829.1    FJ265563    ADI61831.1    + More
FJ265562    ADI61830.1    ODYU01008249    SOQ51673.1    KZ150485    PZC70710.1    GBGD01000380    JAC88509.1    ODYU01004088    SOQ43598.1    GBBI01004876    JAC13836.1    KZ149907    PZC78256.1    FJ265542    ADI61810.1    FJ265550    ADI61818.1    FJ265549    ADI61817.1    FJ265551    ADI61819.1    FJ265545    ADI61813.1    FJ265544    ADI61812.1    FJ265543    ADI61811.1    JARK01001655    EYB84321.1    JARK01001736    JARK01001462    JARK01001379    JARK01001338    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    JARK01001475    EYB97550.1    JARK01001470    JARK01000204    EYB98081.1    EYC40601.1    EYC33297.1    JARK01000063    EYC44387.1    JARK01001628    JARK01001583    JARK01001528    JARK01001506    JARK01001467    JARK01001463    JARK01001457    JARK01001432    JARK01001420    JARK01001403    JARK01001371    JARK01001369    JARK01001360    JARK01001353    JARK01001349    JARK01000603    JARK01000080    EYB85741.1    EYB88438.1    EYB92544.1    EYB94540.1    EYB98080.1    EYB98468.1    EYB98899.1    EYB99568.1    EYC03088.1    EYC05014.1    EYC08153.1    EYC15852.1    EYC16408.1    EYC19456.1    EYC22445.1    EYC24734.1    EYC24778.1    EYC24866.1    EYC33488.1    EYC35672.1    EYC43798.1    JARK01001581    EYB88505.1    JARK01001389    EYC10874.1    JARK01001639    EYB85201.1    JARK01001344    EYC28216.1    JARK01001372    EYC15614.1    JARK01001497    EYB95322.1    JARK01000302    EYC38674.1    JARK01000165    EYC41537.1    JARK01000173    EYC41342.1    JARK01000008    EYC46079.1    JARK01001340    EYC30744.1    JARK01001421    EYC04912.1    JARK01001401    EYC08686.1    JARK01000146    EYC42042.1    JARK01001500    EYB95049.1    EYC11015.1    JARK01000161    EYC41641.1    EYC03125.1    JARK01001612    EYB86585.1    JARK01001346    EYC26445.1    JARK01000109    EYC42952.1    JARK01000388    EYC37469.1    JARK01001370    EYC16150.1    JARK01001348    EYC25048.1    JARK01001473    EYB97806.1    JARK01001618    EYB86258.1    JARK01001582    EYB88498.1    JARK01001357    EYC20551.1    EYC25050.1    JARK01001407    EYC07212.1    JARK01000177    EYC41209.1    JARK01001637    EYB85284.1    EYC41210.1    JARK01001531    EYB92324.1    EYC25046.1    EYB98082.1    EYC40602.1    EYB85282.1    JARK01001502    EYB94855.1    EYC30828.1    JARK01000460    EYC36749.1    EYB85285.1    JARK01000132    EYC42415.1    EYC25049.1    JARK01001621    EYB86109.1    JARK01001626    EYB85833.1    JARK01001565    EYB89683.1    JARK01001524    EYB92970.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    JARK01001568    EYB89432.1    JARK01001337    EYC34625.1    JARK01001365    EYC18009.1    EYC18010.1    EYB86257.1    EYB86256.1    JARK01001343    EYB95040.1    EYC28825.1    JARK01000030    EYC45383.1    EYC45382.1    JARK01000046    EYC44894.1    JARK01001428    EYC03684.1    JARK01001388    EYC11165.1    JARK01001354    EYC21986.1    JARK01000347    EYC38051.1    JARK01001580    EYB88618.1    JARK01000077    EYC43894.1    JARK01001730    EYB81048.1    GDKW01001596    JAI54999.1    JARK01001380    EYC13322.1    JARK01001711    EYB81734.1    EYC25145.1    JARK01001700    JARK01001393    EYB82228.1    EYC10181.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR029052   Metallo-depent_PP-like       
IPR017452   GPCR_Rhodpsn_7TM       
IPR036423   SOD-like_Cu/Zn_dom_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF49329   SSF49329       
Gene 3D
PDB
6AR3     E-value=5.08819e-05,     Score=115

Ontologies

Topology

Length:
906
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0537400000000001
Exp number, first 60 AAs:
0.04441
Total prob of N-in:
0.00243
outside
1  -  906
 
 

Population Genetic Test Statistics

Pi
0.531094
Theta
11.173587
Tajima's D
-2.524236
CLR
5.340309
CSRT
0.000249987500624969
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号