SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00162
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon X-element       + More
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.188
 

Sequence

CDS
ATGGTCAGGAACGACAGGCTCTCTGCTCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCATTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGCATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACACGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACACCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGAGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGACTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGTTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCAACATTAGATAGATCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGATGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTAGTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGACGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCAGCGTTTGATGATGACGAAAAAGCAGAGTTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAAAATTAGTAGACAGTGAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACCGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTATTCAACATGGGTGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTTTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTTTCACCCCTCCTATTCAGCTTATTCGTTAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCCAGTAGAAACAAGTCCCTAATCGCGAAGAAGCTTCAGAGTGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGTATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCCTTAGTCAATCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTATCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTTCAATCTTTACAATCCCGCTTTTGCAGGTTAGCCGTCGGAGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCTATACAGAAATACATGAAGTCAGCGTCGGAACGGTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTAGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCACTAGACGCCTTCAGCTCTAGGAGCAGGCTGAGGGACCCCGAGGTACATTTTTGTGAGAAAGGTGTAAAAACGAATGCAGTTGTGTATCAAAATACAGTCCTGACGAACCTTATGGAACCTGTTTCTCATACCATGTTCAATAACAGGCACTGGGTATTCCAACAAGATTCGGCACCAGCTCATAGAGCGAAGAGCACACAAGACTGGCTGGCGGCGCGTGAAATCGACTTCATCCGGCACGAAGACTGGCCCTCCTCCAGTCCACATTTGAATCCGTTAGATTACAAGATATGGCATCACTTGGAGGAAAAGGCGTGCTCAAAGCCTCATCCCAATTTGGAGTCACTCAAGACATGCTTGATTAAGGCAGCCGCCGATATTGACATGGACCTCGTTCGTGCTGCGATAGACGACTGGCCGCACAGAGTGAAGGCCTGTATTCAAAATCACGGAGGTCATTTTGAATAA
Protein
MVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIIIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDTLVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLSLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSTPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRSRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVKLVDSEAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANRIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFFSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLLSQSIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIQKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSRSRLRDPEVHFCEKGVKTNAVVYQNTVLTNLMEPVSHTMFNNRHWVFQQDSAPAHRAKSTQDWLAAREIDFIRHEDWPSSSPHLNPLDYKIWHHLEEKACSKPHPNLESLKTCLIKAAADIDMDLVRAAIDDWPHRVKACIQNHGGHFE

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon X-element
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    GALX01005299    JAB63167.1    GALX01005359    JAB63107.1    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    ABLF02042518    ABLF02057746    GBBI01004395    JAC14317.1    GGMR01018716    MBY31335.1    ABLF02008153    ABLF02008462    ABLF02008464    GGMS01006359    MBY75562.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GBBI01004571    JAC14141.1    NEVH01006736    PNF36716.1    GFTR01008038    JAW08388.1    GFTR01008262    JAW08164.1    GEZM01053022    JAV74219.1    ABLF02034467    NEVH01011985    PNF31054.1    NEVH01021205    PNF19912.1    NEVH01017470    PNF24199.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    ABLF02024246    GFTR01008279    JAW08147.1    NEVH01016302    PNF25823.1    GGMS01002992    MBY72195.1    ABLF02028535    ABLF02028545    NEVH01022639    PNF18527.1    GGMR01000676    MBY13295.1    ABLF02041767    LBMM01013518    KMQ85605.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    KK119692    KFM76444.1    ABLF02023911    NEVH01026386    PNF14434.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    DNOY01000259    HBE18313.1    RPOV01000134    RPJ78669.1    S59870    AAB26437.2    GFXV01000908    MBW12713.1    GFTR01008271    JAW08155.1    AF237761    AAF81411.1    GFTR01008261    JAW08165.1    GFTR01008251    JAW08175.1    GGMR01000226    MBY12845.1    NWSH01007753    PCG62823.1    AY060438    AAL25477.1    GGMR01016905    MBY29524.1    NEVH01020940    PNF20481.1    GBGD01000415    JAC88474.1    GFTR01008256    JAW08170.1    GGMR01003864    MBY16483.1    GGMR01003407    MBY16026.1    GFTR01008246    JAW08180.1    GFTR01008151    JAW08275.1    GGMS01017365    MBY86568.1    GGFJ01001858    MBW50999.1    KU543685    AMS38375.1    GGFJ01001857    MBW50998.1    GEZM01084969    JAV60363.1    GECL01003538    JAP02586.1    GGFJ01001822    MBW50963.1    GFXV01002840    MBW14645.1    GGMR01006408    MBY19027.1    KU543673    AMS38352.1    GEDC01000337    JAS36961.1    GGFJ01001844    MBW50985.1    M17214    AAA28508.1    NEVH01005277    PNF39135.1    NWSH01000032    PCG80496.1    GGFJ01001842    MBW50983.1    GGFJ01001843    MBW50984.1    GBBI01003810    JAC14902.1    GGMR01011511    MBY24130.1    GBBI01003747    JAC14965.1    ABLF02014118    ABLF02014121    ABLF02054790    GGMR01016296    MBY28915.1    NNAY01003095    OXU19992.1    GGMS01000737    MBY69940.1    ABLF02040174    ABLF02040183    ABLF02055266    GFTR01008269    JAW08157.1    GGMR01012443    MBY25062.1    GBGD01000389    JAC88500.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
5CR4     E-value=2.17784e-07,     Score=136

Ontologies

Topology

Length:
992
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.807109999999997
Exp number, first 60 AAs:
0.07966
Total prob of N-in:
0.01816
outside
1  -  992
 
 

Population Genetic Test Statistics

Pi
11.353186
Theta
13.481422
Tajima's D
0
CLR
0.090417
CSRT
0.377581120943953
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号