SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00107
Annotation
PREDICTED:_uncharacterized_protein_LOC105700222?_partial_[Orussus_abietinus]
Location in the cell
Mitochondrial   Reliability : 1.502 Nuclear   Reliability : 2.005
 

Sequence

CDS
ATGGTGAAGACAAGACTAGGAACAGACACCGACATGGCGACGTCTTCGACAAATGGTACGACCGCCGCTGCTGACCAGACCGGGCGAGACCGACAGTCCGTCCACAGCAGTCGCGCACCGTCACCGACCCCGTCTGTCCGGTCCACCGTCTCCAGTGCAATGACTCAGATTCGACGACAAAAACTAATACAACTAAAGTTGGACGCTGCCGAACAACGCGCACGACTACACCTGCAGCTTCTGGAGGAAAAACTAGCCATCGAAAGTCAGGCCCTAGAAGAGGAAGAAGATCCGCAACTGACATGCAATCCACCAGGTAACTCTCAAACATTACCAAACGCACATGACGTAAGATTACCGGCTTGCTGTCAGCAAATTTCAGAAGAGAATGAGCTAGCAAACTGCGTAACTAAGCTCCTCGCAAGACAGTCAAGTACGCGAGAATTGCCTACGTTCTCTGGTGAGCCCGAGGAATGGTCTCTTTTTTATAGTCAATTTACATCGACAACAAAATTATGCGGCTACAGCGATGACGAGAACATAGCCCGACTCGCGCGATGTTTGAAGGGACGAGCACGTGACGCAGTGTACGCGCTTCTTGTTAGCGCTAGCAATCTCGATCGCATTATCAGCACATTAAAATTACGTTTCGGCCGACCAGAAAATATCATCGAAATTTTATTGAATAAAATTCATGCAATACGTGACATACGTCACGACGACATAGACCGTCTAATAGAGTTCGCGACGGCTGTGCAGAATGTCACGGCGACTATGAAATCAACCAAAGAAATAGGACATTTAATGAATCCAACGTTATTACGAGAAATTGTGAGTAAGCTGCCATCGACGTTACGATATCAATGGGCGATACATGCAGCGAGCTTAGGCGTGAAGACCGTCACGCTGTCACATATATCGGAGTGGCTTATGACAATGGCCAACGCTGCTTCATTCATCAGTCCTCTGACCACCAAGACGTCTAGTGATGTGAAACCACCGACCAGACCGGATCCTAGACCTTGGAGACCAGCAGTGATGGCGACGACTCCAACGGCAGTAAATTTATCCTGTACCCTTTGCGGCGATGCGCATGACATACAAAGCTGTGAGAGGTTCATACAGATGACGACAGACGATCGTTGGAGATTCGTAACTGAGAAGAAGTTGTGTTTTTCATGTTTGTCCAGCCGACATCAATTAAGGGCTTGTGAAAAAAAGACGAAGTGTGCTGTTCGCGACTGCATGAGAGTTCATCACACTTTGCTCCACGCTGTGCGACGCGTCATGAAGATTGATAATGCTGTCAACCACACGGACAAGACCGTTAATACTCTCAACAATGCGGATCGGCATGTATTTTTAAAAGTGGTTCCAGTTGTAGTATCCGGAGCGAAAGGTGACGTGCTAACCTATGCACTTTTAGACGAGGGAGCAGCAGTGACACTCGTGAACTCGTCACTTCTGGAGAGAGCTGGCATCACTGGACCGACGTCGAGCCTTCGCATCCGCGGCGCGTCCGGCATGACAACCATCGAACCGAACTCTAGACTAGTTTCTTTTAATATTCGCGGAGTAAATGTATCAAATGTATATAATGTAACTAGTGCACGTTCTGTAAATAATCTTAATATATGTGTAGATAGTTTTAGATATAAGAAAATTGTAAACAAATATCCATGGGTGATTGACTATGTAACTGACTATGACATACGGCCTGACATGATTGAACTTCTTATTGGACAAGACAACATTGATTTGATTATTACTAGACAGATAATACAAAGACATAAGACTGGACCAATAGTTTCTAAGACTGACTTAGGCTACGTAGTTCATGGAAATGTAGGACTGGGTAGTGTACCAGACGATACAACTGTTTTACATTTTTGTCGATGCGATGAACTTCACGAGCTGGTCAAGCAGTCTTTCTCCACAGAGTCGTTTGGTGTTAAGCAGACTGACGACTTTCCTCGTTCTCGAGAGGATCAGCTAGCGCTGAACATCATGGAGCGAACCACTAAGCTCTTACCCGAAGGCAGGTGGGAGACTGGCCTGCTTTGGAAGTCTGACGATCTTCAGCTGCCGGACAGCCTACCGTTGGCTATGACCCGACTCAACGGTGTCCAGAAGAAAATGGTGAGGTACCCAGAGTTTGCTTCTCAGTACAGGTCTAAGATAGAAGAGAATTTGGACAAAGGGTACATCACGAAAATTCAACCAGGAGATCCTGCGACTAAGACTAGGATCTGGTACTTGCCGCATTTTGCAGTCTTCAACCCCAACAAACCGAACAAGCTGCGGATTGTTTTAGACTGTGCTGCGAAGTCTGGTGGTAAGTCATTTAATGATTTCCTACTGCGAGGACCTGACTTTTTGACATCACTACCAGCAGTCTTATTAAAGTTCCGGACAGGAAAGTTTGCTGTGACAGCGGACATACAGGAAATGTTCCACAGAGTTCTCATCCGACCGGAAGATAGACATGCTCAGAGAATTTTGTGGGATGGCGAAACTTACATCATGAACGTCATGACCTTTGGTGCTGTATGCTCGCCGTCATCAGCACAATTTGTTAAAAATATAAATGCTCGTAGGTATGAGACGACAAAACCTGAAGCATATAAAGCAATTGTTGATCACCACTATGTCGATGATTATATCCACTCTTTCGATCATGAAGATGATCTGATCCGGGTGGTGGATGACGTGGTACACATTCATGTTTCAGGTGGGTTTAACTTACGTAATTTTGTATCGAACTCAAAACGTTTACTAGCTCATTTACCGGCTGAGAAACTTGCCCCGAGCTGTCTGAAAATCCTCTCAGACGTTAAAGATGACCAGGTTGAAAGAGTACTCGGAGTGCGTTGGGATCGAGAGACTGACGAATTTCTATTTCATTTGAACTTCCCGAAGGTAAGCGAAGCTATTAAGACAGGCATTAAAAGACCGACTAAACGCGAAGTGATGAGACTTATTATGTCTCTATTTGACCCGTTAGGTTTTTTGCTTTACGTCACCGTGAAGGGTCGTATTCTGCTGCAGACCATATGGAAGTCAAATGTTGGTTGGGATGACGAAGTTGAGCTTAGCCAGTTTGAAAAATGGCAGTCTTGGTTGACTGAGCTTCAAAAGACCAGTGAATTCAGGACTCCACGTTGGTTGTTTAACGACGGATGTGGCAAGCAAGAACCGCCAGAACTTCATATTTTTTGCGATGCAAGCAGCAAAGCTTTCGCCAGTGTGGCATATTTACGAGACAAAACCACTGATGGCAAATGGCACGTGTCTTTTGTTATTGCACGCGCACGTGTTGCACCTCTTAAAGTGATGAGTATCCCTCGACTTGAGCTACAAGCTGCGCTTATGGGTGCAAGACTAGCTCACACTTTGAAGAAAAATATAGACGTGAGTACCGTGACCTACTGGTCTGACTCAAAGACCGTGTTAAGTTGGCTTAGGTCGGACAGTGGCCGTTTCAAGCCTTTCGTAGCCCATCGTGTCAGTGAGATTTCTGAGCTGACTGAGGTCAGTCACTGGAGGTGGGTACCTTCAGGACTGAATGCTGCAGATGACGCCACAAGGGAGACTGTTGCCGAGGACAACACACGATGGATGAATGGACCGTCATTTCTACGTGAGCCCAAAGAGACCTGGCCACCAGATGATTTTATCATAAGTCTGGACCCTGACGACGTTGAGGTTAAGGTTTGCACAATTACTTTAATGACTGTAGAGCTACCCGATGACAGTCGTTTTTCCCGATACTGGAGACTTATCAGGAGCACCGCTTGGTTTATGCGTGCAGTACACAACTGGATGCACAAGAGTAGCAAGCGACACGGTGAGTTGACAGCCGACGAAGTTAAAGTAGCGGAGCTAATCTGGATTAGAGAAAGCCAAAGACGAATGTTCTCAGACGATATAGAAAGTGTCAAGAAAACCGGACAAGTGAAGCGAGATTCTCCGCTCCGTCAACTTACACCATTTTTAGACAAGGACGGCATCCTCCGTGTTCGTGGGAGGATCTGCAGAGCAGATGGTGATAACGATTTCAGGCACCCTATAATTTTGAATCCAAAAGACAGATATGTGAAATTACAACTTATGCAGTATCACGTGGACTCAGCACATAATGGACGCGAACGTGTGCTGCATGAAGTGAGACGACGATTCTGGATAATAAATGGACGTAATGCAGTAAAAATGACATGGAATGACTGTCAGTTCTGCAAGAACAGTCGTGCGAAGCCCTCGCCACCACTCATGGCTGATTTACCAGATGTTAGATTGAAGGAGGTCAGTCGACCTTTCACTTACACCGGGTTAGATTATTTCGGTCCAATTATAGTGAAGGTTGGACGTAGACACGAGAAAAGATGGGTAGCACTATTTACATGTCTGACAGTTCGCTCTATCCATCTGGAGTTGGTTCACGATTTGACAACCAGCTCCGTGTTGATGAGCCTCAGACGGCTGATAGCGAGACGAGGCTGTCCAAGTATTATTTTCAGTGACAACGCGACTACCTTTCGTGGGGCTGACCGTGAACTGAAGCGAGCTGTACAAGCTATCGACAAAGACGAACTCATCACCTTCGGTAGCATCCGACACTTGGAGTGGCGATTCATAGCCCCTGACGCACCTCATATGGGTGGATGCTGGGAGCGGCTCGTGAGATCCGTCAAAACAAGCTTGCGAGTAACGCTCAAGACCAGAACACCTAACGATCAGACATTAATGACACTCCTGGCTGAGGCCGAATTCATGGTGAATTCAAGACCACTGACATACGTACCTCTTGATTTTGACGACGACTTGCCCTTGACTCCGAATGATTTTTTACTACCAAAGACAGAATTTATTGACCATCCTTTCGGAATGTTTACGGACCATGATTTACTGAAACGGACTTGGAGAGAATCTCAACGACTTGCAGACTTGATTTGGAAACGCTGGGTCAAGGAGTACTTGCCCACTTTGACACGACGAGACAAATGGTACAGAGATTCTGACAGACCACTGGCGATTGGTGACGTCGTAGTTGTTGTTGACTCCCAGCTACCCCGCAACCAGTGGCCGCTTGGCAAGATCGAGCAGGTCTTCCCTGGTAAGGACGACATGGTTCGCGTTGCTAAAGTTCGGACTAGACATGGACTCTACACAAGACCGGCGACGAAACTGTGCAGGTTGGACGTACACTCCTCATCTTGA
Protein
MVKTRLGTDTDMATSSTNGTTAAADQTGRDRQSVHSSRAPSPTPSVRSTVSSAMTQIRRQKLIQLKLDAAEQRARLHLQLLEEKLAIESQALEEEEDPQLTCNPPGNSQTLPNAHDVRLPACCQQISEENELANCVTKLLARQSSTRELPTFSGEPEEWSLFYSQFTSTTKLCGYSDDENIARLARCLKGRARDAVYALLVSASNLDRIISTLKLRFGRPENIIEILLNKIHAIRDIRHDDIDRLIEFATAVQNVTATMKSTKEIGHLMNPTLLREIVSKLPSTLRYQWAIHAASLGVKTVTLSHISEWLMTMANAASFISPLTTKTSSDVKPPTRPDPRPWRPAVMATTPTAVNLSCTLCGDAHDIQSCERFIQMTTDDRWRFVTEKKLCFSCLSSRHQLRACEKKTKCAVRDCMRVHHTLLHAVRRVMKIDNAVNHTDKTVNTLNNADRHVFLKVVPVVVSGAKGDVLTYALLDEGAAVTLVNSSLLERAGITGPTSSLRIRGASGMTTIEPNSRLVSFNIRGVNVSNVYNVTSARSVNNLNICVDSFRYKKIVNKYPWVIDYVTDYDIRPDMIELLIGQDNIDLIITRQIIQRHKTGPIVSKTDLGYVVHGNVGLGSVPDDTTVLHFCRCDELHELVKQSFSTESFGVKQTDDFPRSREDQLALNIMERTTKLLPEGRWETGLLWKSDDLQLPDSLPLAMTRLNGVQKKMVRYPEFASQYRSKIEENLDKGYITKIQPGDPATKTRIWYLPHFAVFNPNKPNKLRIVLDCAAKSGGKSFNDFLLRGPDFLTSLPAVLLKFRTGKFAVTADIQEMFHRVLIRPEDRHAQRILWDGETYIMNVMTFGAVCSPSSAQFVKNINARRYETTKPEAYKAIVDHHYVDDYIHSFDHEDDLIRVVDDVVHIHVSGGFNLRNFVSNSKRLLAHLPAEKLAPSCLKILSDVKDDQVERVLGVRWDRETDEFLFHLNFPKVSEAIKTGIKRPTKREVMRLIMSLFDPLGFLLYVTVKGRILLQTIWKSNVGWDDEVELSQFEKWQSWLTELQKTSEFRTPRWLFNDGCGKQEPPELHIFCDASSKAFASVAYLRDKTTDGKWHVSFVIARARVAPLKVMSIPRLELQAALMGARLAHTLKKNIDVSTVTYWSDSKTVLSWLRSDSGRFKPFVAHRVSEISELTEVSHWRWVPSGLNAADDATRETVAEDNTRWMNGPSFLREPKETWPPDDFIISLDPDDVEVKVCTITLMTVELPDDSRFSRYWRLIRSTAWFMRAVHNWMHKSSKRHGELTADEVKVAELIWIRESQRRMFSDDIESVKKTGQVKRDSPLRQLTPFLDKDGILRVRGRICRADGDNDFRHPIILNPKDRYVKLQLMQYHVDSAHNGRERVLHEVRRRFWIINGRNAVKMTWNDCQFCKNSRAKPSPPLMADLPDVRLKEVSRPFTYTGLDYFGPIIVKVGRRHEKRWVALFTCLTVRSIHLELVHDLTTSSVLMSLRRLIARRGCPSIIFSDNATTFRGADRELKRAVQAIDKDELITFGSIRHLEWRFIAPDAPHMGGCWERLVRSVKTSLRVTLKTRTPNDQTLMTLLAEAEFMVNSRPLTYVPLDFDDDLPLTPNDFLLPKTEFIDHPFGMFTDHDLLKRTWRESQRLADLIWKRWVKEYLPTLTRRDKWYRDSDRPLAIGDVVVVVDSQLPRNQWPLGKIEQVFPGKDDMVRVAKVRTRHGLYTRPATKLCRLDVHSSS

Summary

EMBL
LNIX01000019    OXA44855.1    LNIX01000015    OXA46575.1    LNIX01000003    OXA57597.1    + More
LNIX01000039    OXA39294.1    LNIX01000007    OXA52015.1    LNIX01000004    OXA55241.1    GAMC01017930    JAB88625.1    GGFL01001682    MBW65860.1    JXUM01127084    KQ567147    KXJ69602.1    GEZM01052586    JAV74401.1    JXUM01136032    KQ568367    KXJ69026.1    LN877231    CTR11689.1    GGFL01001842    MBW66020.1    JXUM01111221    KQ565482    KXJ70922.1    AF530470    AAQ09229.1    JXUM01130316    KQ567562    KXJ69370.1    GDHC01018323    JAQ00306.1    GEHC01000921    JAV46724.1    AB110069    BAD01590.1    BAD01589.1    GGFJ01000306    MBW49447.1    OXA56382.1    GEHC01000947    JAV46698.1    GGFL01005193    MBW69371.1    GGFJ01000333    MBW49474.1    KQ459986    KPJ18861.1    JXUM01038372    KQ561162    KXJ79503.1    GGFJ01000218    MBW49359.1    OXA56250.1    GGFJ01000302    MBW49443.1    GEHC01000945    JAV46700.1    GEHC01000967    JAV46678.1    GEHC01000914    JAV46731.1    KL367480    KFD71819.1    AAGJ04043389    GGFJ01000432    MBW49573.1    GDIP01004568    JAM99147.1    GDIP01036233    JAM67482.1    GGFJ01000470    MBW49611.1    GGFJ01000471    MBW49612.1    GGFJ01000487    MBW49628.1    AAGJ04115911    AAGJ04040339    GEHC01000913    JAV46732.1    GEZM01052587    JAV74399.1    AAGJ04095911    GDIQ01002920    JAN91817.1    GDIP01030392    JAM73323.1    GDIQ01002921    JAN91816.1    GAMC01020598    GAMC01020596    GAMC01020592    JAB85959.1    GEHC01000955    JAV46690.1    JXUM01005879    KQ560203    KXJ83865.1    KL367687    KFD60188.1    GEHC01000872    JAV46773.1    KL367737    KFD59786.1    AAGJ04001285    KL367527    KFD66131.1    AAGJ04091218    JYDN01000258    KRX52286.1    FN356218    CAX83707.1    JYDO01000040    KRZ75306.1    JYDV01000070    KRZ36622.1    JYDS01000555    KRZ02797.1    AAGJ04058558    JYDU01000375    KRX86446.1    JYDP01000296    KRZ01365.1    JYDT01000008    KRY92224.1    KRZ75294.1    KL367570    KFD63600.1    HAEJ01004007    SBS44464.1    BK004068    DAA04498.1    JYDV01000007    KRZ44161.1    JYDM01000405    KRZ82011.1    JYDM01000410    KRZ82006.1    JYDM01000406    KRZ82010.1    AAGJ04173907    AAGJ04141734    JYDO01000345    KRZ65499.1   
Pfam
PF01565   FAD_binding_4        + More
PF17921   Integrase_H2C2
PF18701   DUF5641
PF05380   Peptidase_A17
PF09129   Chol_subst-bind
PF03564   DUF1759
PF00665   rve
PF05585   DUF1758
PF00078   RVT_1
PF00628   PHD
Interpro
IPR001878   Znf_CCHC        + More
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR001584   Integrase_cat-core       
IPR016164   FAD-linked_Oxase-like_C       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR005312   DUF1759       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR040676   DUF5641       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR008737   Peptidase_asp_put       
IPR000477   RT_dom       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR019786   Zinc_finger_PHD-type_CS       
IPR002999   Tudor       
IPR001841   Znf_RING       
IPR000253   FHA_dom       
IPR001995   Peptidase_A2_cat       
IPR021109   Peptidase_aspartic_dom_sf       
IPR036875   Znf_CCHC_sf       
IPR013087   Znf_C2H2_type       
IPR001969   Aspartic_peptidase_AS       
SUPFAM
SSF53098   SSF53098        + More
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF57903   SSF57903       
SSF57756   SSF57756       
PDB
5UOQ     E-value=0.0569388,     Score=91

Ontologies

Topology

Length:
1738
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.145
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00131
outside
1  -  1738
 
 

Population Genetic Test Statistics

Pi
23.964547
Theta
37.578496
Tajima's D
-0.98865
CLR
0
CSRT
0.139543022848858
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号