Gene

KWMTBOMO00094  Validated by peptides from experiments

Pre Gene Modal

BGIBMGA002114

Annotation

putative_laminin_A_chain_[Danaus_plexippus]

Location

Bomo_Chr1(+):2688957-2728729      View in EpiBrowser

Full name

Laminin subunit gamma-1       + More
Laminin-like protein lam-2      
Laminin subunit gamma-3      
Laminin subunit alpha-1      
Laminin subunit alpha-2      
Laminin subunit alpha      
Laminin subunit alpha-5      
Laminin-like protein epi-1      
Netrin-1      
Netrin-3      
Netrin unc-6      
Laminin subunit beta-1      
Netrin-A      
Laminin subunit alpha-3      
Laminin subunit beta-4      
Basement membrane-specific heparan sulfate proteoglycan core protein      
Laminin subunit beta-2      
Netrin-4      
Laminin subunit beta-3      
Usherin      
Netrin-G1      
Netrin-G2      
Netrin-B      

Alternative Name

Laminin B2 chain
Laminin-1 subunit gamma
Laminin-10 subunit gamma
Laminin-11 subunit gamma
Laminin-2 subunit gamma
Laminin-3 subunit gamma
Laminin-4 subunit gamma
Laminin-6 subunit gamma
Laminin-7 subunit gamma
Laminin-8 subunit gamma
Laminin-9 subunit gamma
S-laminin subunit gamma
Laminin-12 subunit gamma
Laminin-14 subunit gamma
Laminin-15 subunit gamma
Laminin A chain
Laminin-1 subunit alpha
Laminin-3 subunit alpha
S-laminin subunit alpha
Laminin M chain
Laminin-12 subunit alpha
Laminin-2 subunit alpha
Laminin-4 subunit alpha
Merosin heavy chain
Laminin-10 subunit alpha
Laminin-11 subunit alpha
Laminin-15 subunit alpha
Epididymis tissue protein Li 131P
Netrin-2
Uncoordinated protein 6
Laminin B1 chain
Epiligrin subunit alpha
Kalinin subunit alpha
Laminin-5 subunit alpha
Laminin-6 subunit alpha
Laminin-7 subunit alpha
Nicein subunit alpha
Netrin-2-like protein
Epiligrin 170 kDa subunit
Laminin-1 subunit beta
Laminin-10 subunit beta
Laminin-12 subunit beta
Laminin-2 subunit beta
Laminin-6 subunit beta
Laminin-8 subunit beta
Laminin beta-1-related protein
Perlecan
Laminin chain B3
Laminin-11 subunit beta
Laminin-14 subunit beta
Laminin-15 subunit beta
Laminin-3 subunit beta
Laminin-4 subunit beta
Laminin-7 subunit beta
Laminin-9 subunit beta
S-laminin subunit beta
Laminin B1s chain
Beta-netrin
Hepar-derived netrin-like protein
Epiligrin subunit bata
Kalinin B1 chain
Kalinin subunit beta
Laminin B1k chain
Laminin-5 subunit beta
Nicein subunit beta
Usher syndrome type IIa protein
Usher syndrome type-2A protein
Usher syndrome type IIa protein homolog
Usher syndrome type-2A protein homolog
Laminet-1
Laminin beta-1-1 chain
Laminet-2

Location in the cell

Nuclear   Reliability : 2.899

CDS

ATGGCGCGGCCGCTCATTTACACATATTTGCTCAGTATCTTGAGCGTAGCCGTGGCTCAGAATTATTACCAAACGCCGAGGGTCGGCTCTAAACGAGCCTCTTGTTATAAATCCGATGGAAAACCTCAAAGATGCATACCAGAGTTCGAGAACGCCGCCTATTTGGTCCAGATGGAGGCGACCAACACCTGTGGAGACAACGGAGTAAAGTTATACTGCATACAGACATCCGCTGGGACGTCTACAAGGTCCTGTGACTACTGTCAACCAGGACAGTTCTCCAGCTATTACTTAACCGACCTTCATCACGAGCAGGACAACCAGACTTGGTGGCAGTCGGAGACAATGAAGGAAGGCATCCAGTACCCCAATCAAGTGAATTTGACCTTACATTTGGGCAAAGCGTATGATATTACGTATGTCCGGATAGTGTTTTATTCGCCTCGACCTCAAAGTTTTGCAATTTACAAGAAGACAAACGAAGACAAAGTTTGGGAGCCATTCCAATATTTCAGTGCCTCATGTCGAGAAACTTACGGAGTTGAAGAGCAGAAAAGTGCTGAATTAGGTGCGGAGACTAGGGCTCTCTGCACCAGCGAATATTCAGATATATCTCCGTTATCCGGAGGCAACGTGCCGTTCTCGACGCTGGAGGGACGACCTTCGGCATATACGTTCGACAGCAGTCCCGAATTACAGGACTGGGTGACGGCTACCGACCTGCGTATCTCCCTCGACCGCCTCAATACCTTCGGTGACGAGATCTTCGGGGACGTCCAGGTCCTACAATCGTATTGGTACGCTATTGCTGATGTGGCTGTGGGCGCCAGGTGCAAATGCAACGGCCACGCATCAGTGTGCGATTCTCAACAGCAGCCTGACGGAACAAAGACCAGATCGTGCCGATGCGAACATAACACTGCTGGACGCGAATGTGAACGTTGCTTAGATTTCTATAATGACGCGCCGTGGGGACGTGCTTCATCTACCAACGTGCATGAGTGCAAGGCGTGCAACTGCAACGGTTTCTCGAACAAATGCTACTTCGACAAAGAGTTGTACGAAAGGACCGGACACGGAGGGCACTGTCTCGAGTGCAGTGACAACCGAGACGGCCCCAACTGTGAGCGGTGCAGGGAGAACTTCTACCAGAGTCCCGAAGACATCTGTTTGCCTTGCAACTGTAACCCTACCGGTTCTCGAAGCCTTCAATGCAATGCAGAAGGCAAGTGCCAATGCAAGCCCGGAGTGACAGGGGACAAGTGTGACGCCTGTGCGCCGAACCATTACGAGTTTACGAACCAAGGATGCAAGCCTTGCGGCTGTAACGAGTCCGGGTCGTACGGCAACACCCCTCAGTGCGACCCGCAGACCGGTGTCTGTCTGTGCAAACAGAACGTCGAGGGCAGACGCTGTCGGGAGTGCAAGCCCGGCTTCTTCAATCTAGATTTACAGAACGAGTTTGGATGCACACCCTGCTTCTGCTTCGGCCATTCGTCCCAGTGCAGCTCCGCTCCGAAATACCAGGTTCACGACATCAGCGCTCATTTCATTCGAGACTCGGAGAAGTGGGATGCTGTTGATGAAACAGGCAAACCGGCACAATTGCAGTTTAATGCTAATACGCAGAATATAGCGGTCGTGTCAAAGAATACTGAGATCGTTTATTTCCTTGCGCCGAATCAATTCCTTGGCGATCAGCGGCCATCGTACAACCACGATATGAAATTTTCGCTGAAATTAGGCGAACATAGTGGCTATCCATCTGCTCAGGACATTATCCTCGAGGGCGCCCGGACTTCTATTTCAATGAACATTTACGGACAGAACAATCCAGAACCCACTGATCAACCTCAAGAGTATACGTTCAGACTGCAGGAAGACCCTCGCTACGGCTGGTCTCCGACGCTTTCGAACTATGAGTTCATGTCGATCCTTCAGAATTTGACGGCAATCAAAATCAGGGGAACATACAACAAAGGCGGTGTCGGGTACCTGATCAACTTCAAGTTGGAAACGGCCAAGATTGGCAGAGAGAAAGGGGCGGCTCCAGCTAACTGGGTGGAGAAATGCTCGTGTCCCAAAGCCTATGTTGGGGACTACTGTGAAGAGTGCGCACCAGGGTTCAAGCACGAGCCTGCCAACGGCGGACCGTACTCGACTTGCATACCTTGCGATTGTAACGGACATGCCCATATTTGTGACACCGCGACTGGATTCTGTATCTGTAAGCACAATACGACCGGTAGCAACTGTGAGCTCTGCGCGAAAGGTTTCTACGGGAATGCTATCGCTGGAACTCCAGACGACTGTAAGCCTTGTCCCTGTCCGAAGGACAGTGGTTGCATCCAACTCATGGACCAGAGCATCGTGTGTACTGACTGTCCCGACGGTTACGCTGGACCGAGGTGCGAGGTTTGCGCCGACGGGCACTTCGGCGATCCTAACGGGCAGTTCGGGCCTCAGAAGCAATGCGAGGAATGTCAGTGTAACGGGAACGTCGACCTCAATGCTGTCGGCAACTGCAACCGAACCACCGGGGAGTGTCTCAAGTGCATCTACAACACGGCCGGGCAGCACTGCGACAAATGCCTCAGTGGTTACTACGGTGACGCATTGGATCCTAAACAGAAGGGTGATTGCCAGCCCTGCGAGTGTCACGAAGGCGGGACGGTAGAGAGTCCCGAGGGACCTCCTCTATGTGACGGACTTACAGGATACTGCACCTGCCGACCTCACGTTATCGGCAAAAACTGCGATAAGTGTGAAGACGGCTACTATAACATCTTCTCCGGCGATGGCTGCAAGCCCTGCGACTGCAATCTCGAGGGTTCGTACAACAGCACCTGCCATCCGCGCACGGGGCAGTGCTACTGCAAACCAGGAATCGATGGGAAGCACTGCGATCGCTGCCGAGACTACCACTACGGTTTCTCAGTGGAGGGATGCAAGGGTTGCGACTGTGATGAGTGGGGTTCCACCAACTACCAGTGCGACGTCTCCGGGCAGTGTACCTGCCAGGAAAACGTTGAAGGACGCCGCTGTGACAGTTGGAACCCGGAGCTAAAACCACAACGAGGGCCAACCATGCCGTCTTGGAGGAGTGGTTCGGCGTCAGGTAATGTGAGACCTAGCGGATCAGGTACCTTTAGGAATACAGGCAACTTTAGACCACAACTAAATGTACCTCGACAGCAAATAAACCCACCACAAAGAGTATCAGACGTCACTATGAGCCACATGAACGAGGAAGAAAAACGGGAAATTACTAAAATCTGCTATCAGTACCGTGACATATTCTACTCGGAAAACATTCCTTTATCGTTTACCCATACAGTAAAACACGAATTAAGACTAACCGACGACACCCCCATCTTTGTACGAAGTTATAGACAGGCTCCCCAACAACGAACAGAGATACAGAAACAGGTAGATAGTCTATTAAAACAAGGAATCATTAGGGAAAGTATCTCCCCTTGGTCGTGCCCGGTACACATTGTTCCAAAAAAACCGGATGCATCAGGAAAAGTTAAATGGAGACTTGTTATTGACTATAGAAGACTTAATGACAGAATTATAGAAGACAAGTACCCCTTACCAAACATTAACGACATCCTTGACAGATTAGGGCGCGCACAATATTTCACGACCATAGATTTAGCAAGCGGCTACCATCAATTAGAAATGCACCCTAAAGACGTAGAGAAAACAGCGTTTACTACTGAAAGAGGCCACTATGAGTTCCTAAGAATGCCTTTCGGACTAAAAAATGCCCCGAGCACTTTCCAGCGTCTTATGGACCATATACTCCGAGGTATAGACAACGTATTTACGTACTTAGATGACGTCATAATAGCGGCGACGTCCCTACAAAACCACAATGAAAAACTGAAATTAGTATTTCAGCGATTCAAAATGCATAATTTGAAAGTTCAGTTAGACAAATCAGAATTTCTACAGAAGCACGTTAACTTTCTAGGACATGAATTGACGGACCAAGGACTAAATCCTAACAAGGACAAAATTAAAGCAGTATTAAATTTCCCTATACCACAAACGCAAAAAGACATAAAAGCTTTCTTAGGACTAGTCGGGTACTATAGGAAGTTTATAAAGGACTTTGCGAAGTTGACGAAACCTTTAACAGCATGTCTAAAAAAGAACGCAAAGGTTGAACATACAAACGAATTTTTAGACGCAGTTGATAAATGCAAACAAATTCTAACAAACGCCCCAATCCTGCAATACCCTGACTTCGACAAGCCGTTTATTTTAACGACAGACGCATCTGACTTTGCTTTAGGAGCAGTACTTTCCCAAGGCAATGTGGGCTCAGATAAACCAGTAGCCTATGCCTCAAGGACATTATCAGATACTGAGATCCGTTACTCTACCATAGAGAAAGAACTGTTAGGGATAGTATGGGCAATTAAGTATTTTAGACCTTACTTATATGGCCGTAAATTTACAATTTATACGGACCATAGACCCCTTACATGGTTAATGAGTCTAAAGGACCCTAACTCTAAATTAACACGATGGAAACTAAAGTTGGCAGAGTATGATTACAAAGTTGTTTATAAAAAGGGCAAACAAAACACTAACGCAGATGCACTATCCCGAGCAAAAATTTTTCATAATAGTATAGATTCTCTAGCTGTTAATGTTGACGACAATAGTGACGACAACATAATAAATAGAATATTCGAAAACGCCCGTAGACAGGCAGAGGTAGAAACTAATGACCCGAATAACCAAGACAATGAACGTAACAATACTGACAATGACGACCAACCTTATAACAACAATGACGTAGAAATGACCAGTATCTATCCCTCTCAAATTGACGAAGAGACAGACACAAGGAGTGCAACAACAGTCGACCCCGATCAATTAGTTTCTACAAATCATACCCAACCTGATAATGAAAATAACGGTATCCCTATAATATCCGACGCTATTGATAGACAGTTGAAACAATTTTACGTTAGGTCCACACCAGGTTCTACATACAGAGTAGAGGACAGATCAACAAACTCTAGGACAGTTATTAAGGATGTTTTCATCCCAGTAAATAACACTGAATCAGAAATTATCAAATTTTTAAAGGAACACACAATAGCTGACCGTGTTTTTCATTGCTATTTTTACGACGAAAATCTATACTTAGCCTTTTCAAGAGTGTATACTACGATCTTTAATGACAGAGGACCTAAATTAATAAGATGTACTTCGCGGGTCACACTTGTTGAAAATAAAACTGAACAACAAGAACTCATTAAGCGATATCACGAAGGTAAATCATCGCATCGCGGTATCCAAGAGACCTTTAAGCATCTGCATAGGAATTATCACTGGCCTAATATGTTATTGACAGTTCAAAGGTTCATTAATCAATGCGACCTTTGCCTAAAGGCCAAATATGAAAGAAATCCCTTAAAACCTCCATTGATTATAACAGAGACACCTACGAAGCCATTTCAACACTTGTTCATGGATCTCTATAGTACTGGAGGTGCAACGTTTTTAACAATTATCGACAATTTCTCTAAATTTGCCCAGGCGGTGCCTCTGAATGCTTCTAGTAGTGTTCACATCGCAGAAGCTCTATTACAAGTATTTTCTGTACTAGGACTACCTCTTAAAATCACCACAGACTCAGATACAAAGTTCGATAATGACGTCATAAAAGAGATATGTGCTTCGCATGATATCCACATTCACTTCACGACGCCTTACAACCCAAACTCTAACTCACCCATTGAACGATTTCATTCAACCATCGCAGAAATAATAAGAATTCAAAAAATGACAAATAAAGACGACCCCATACAATTGATCATGAAATACGCTATCATCGCCTATAACAACGCTATTCATTCTACTACAGGCTATACACCACGTGAGCTTTTATTCGGTCATACGGCATCCCGAAATCCATTAGAGCTATATTATCCTAAAGAATTTTATCAAGATTATGTCCTCAATCACCGCAAGAATGCAGAAGCAGTACAGGAATGTATAGCAGCCCACGTGTCTAAGAACAAAGAGCAGGTAATAGAAAAGAGAAACCAGGCAGCGGAAACAATCACGTTTAAGGTAGGTGAAACCGTTTACAAACAGGTCGCCAAAACCACCAGGAGCGACAAGACAAAACCAGTATTTAAAGATAAACAAAACCTCACCATTATTCCTAAATCCAAATACCTAGCACTGGGAACCAACGAGTACTCATACCTGGAGGAAGATTGCAAGAAGATCACACAAGACGTCCAACTCTGCACATCGCTGAACACCCAACCTGTGGAGAACTCTGAAGACTGCATAGTAACTCTTATAAAACACGAGAGCACAAACTGCACCCGTGCCAGGATGAACCTGAAACAAGGCAAGATCCAGAGACTAGAAGACAACAAATGGCTTATCATCTTGAAAGACGAACAAATCCTGAAATCTCGCTGCGGAAGGAAATCTGACTATAAAAAGATGTCAGGAATATACATCGCCAGCATTACAAGCGATTGTCAAGTGGAAATATTCAACCGAACACTGAAGACAAACACGGACACTATTACAGCTGATGAAATCGTACCCATTCCCAGCGAAACCACTATTCTAGAAGGGAATATTCGCTATAACCTACAACTGAAAGATATATCTCTGGATAGCATCCACGAACTGATGGACCGGGTCGAAAACATTCAACAACCTATCATCGACTGGCAGACTATGATGACTACCCCAAGTTGGTCAACACTGGGACTCTACCTCATTCTGATAGCAATAATCATCTGGAAGCTGTGGCAGTGGAGACAGCGACGACTACAATCAAAGAACGAGAGCCCCGAGAACACTAGCACCGAGGACGCTGCTGGAAGCTGCGGGACGCGCTTCTATCTTAAGGAGGGAGGAGTTAGGCAATCGCCCGATGCCCTGTATATTGTTGCAACTTCCAGATGTATGGAGAACAAAAAGCGTCGTCTCGATGGCCAGGGTTGTGAGGACTGTCCCCCTTGCTACAATTTGGTTCTCGATGCGGTCAATCAGCACAGACGTGAGCTGCAAGAGCTTGATGAGATTTTGGCTAAAATATCGAAGGCTCCAACGGTGGTGGAAAACGCTGACTTCGATAATGAACTGCAGCGTGTCAGAGCCGAGATAGAGAGCTTATCTCAGGAAGCACAAATAGGCCTTGGCAACACAGGGGGCTCCAGCCTCACCGACAATTTGGCTGAACTGGCTGACAGACTTGCTGACATTAGAAATATGCTCTTCAAAATCGAGGACGAGAGCTTTGACGGCAACGAAGCTGTTGAGAAGAGCAAGGGAAATGTCTCCAAAGCCGAGGGCACCATAGAGGCCGCCCAGAAGGAAATCAACAGCGCTCTGGAGTACTTGGACGGGGAAGGAGCAGCAGCGTTAGCGAAAGCGCGCAACAGATCAGACCAGTTTGGCAAGCAGTCCGTGGACATGTCAGCGCTCGCCAAAGAATCCAGGCTTCTCGCTGAGAAGTTAGAGAACGAAGCAAGGAACATCAGAGATATAGCGGACAAGGCCTTCAACTCTTCGCTTGTCGCAAACAAGATCGCCAAAGATGGCATCAATAAACAAGCCAATATTAGTAACGAGGTTCAGATCCTAACGAACGAACTGAATGCGGCTTCGGGAAAACTGAACAGTATGACAGAGCTTGCCGATCAAGCTTTAAAGAGAGCCAGAGCTGTGTATGACGAAGCTTTAGGTCTGTACGCGGAGGTCAACACCACGCTGCTGCCCGACATCAAGCTCAACAAGCTTCACGAAGATTCAATGGAGATGAATAGAACGATTGATGAGAAATCAGCAGAGCTGGACCGTTTGATAGCTGAGAACGAAGACACCCTTCACAATTTAGAGGATGGCATAAGGCGCGGTCGGGACTTGCTGGAACAAGGTCACGACAGGCAGGAGGAACTCAACGATCTCCTCGCTAAGCTGGATGAGCTGCAGGCGCAAGCTAAAAACGATGTGGAACTCACGAAAGCCACGTTGACAGCCGCAAATGAGATTTACAAGACTTTAAAAGAGTTCAGTGATCAAGTGACCGAGTCGCACAAGCAAGCGATCCAAGCCACGATGGACGTGCCGGCCGTCCAAGAGAAGGTAGCGGCGGCCGAGGAGAGCATCAACAGCATCACCGAGGAGTTGGTCGCCGCCAGTGACAAGGCGAAGGAGGCCAGGGACTTGGCCCAGCAGGCGCAAAAGGAATATGCCGACAAAGCTTCTGAGGCCGCCCACGAAATCAAGAAGAAAGCGTCCGCTGCCAAAGCAAAAGCTGTGAACTTGAGAGACGAGTCAGACAAACTGATTACTCGTGTGCGAGGTACGGAGAAACAGATCGAGGAGTTGGAGAAAAAAGCAGCCGACAACATGCAGTTAACGCGTGACGCAAAAATGAAGGTTGGTCAGGCGAATATCGACGCTCGGGAAGCTGAGAAACAAGTCACCAAAGGTCTTGAGGATCTGAAAGTCATTATGGATGAGCTGCAGAATCTCCCAACGCTCGACGATGAAGCATTGGACAGATTAAAGGAAAGCTTGGACAGTGCCGAAAAAGCATTGAGAGGTGTAGATCTTGATGGGAAAATAAAAACATTGACAGAAGCCAAGAATAATCATCAGAGATGGATGAAAGAATATCAAGATGAGCACGACCTCCTTCGGTCTGAAGTTGAGAACGTCAAGGGCATCCTTGAACAGCTTCCAGATGGATGCTTCAAGCGGATCGTACTGGAGCCCACCGAAGGACCGAGCAGGTCGGCCAATTATAGGTAG

Protein

MARPLIYTYLLSILSVAVAQNYYQTPRVGSKRASCYKSDGKPQRCIPEFENAAYLVQMEATNTCGDNGVKLYCIQTSAGTSTRSCDYCQPGQFSSYYLTDLHHEQDNQTWWQSETMKEGIQYPNQVNLTLHLGKAYDITYVRIVFYSPRPQSFAIYKKTNEDKVWEPFQYFSASCRETYGVEEQKSAELGAETRALCTSEYSDISPLSGGNVPFSTLEGRPSAYTFDSSPELQDWVTATDLRISLDRLNTFGDEIFGDVQVLQSYWYAIADVAVGARCKCNGHASVCDSQQQPDGTKTRSCRCEHNTAGRECERCLDFYNDAPWGRASSTNVHECKACNCNGFSNKCYFDKELYERTGHGGHCLECSDNRDGPNCERCRENFYQSPEDICLPCNCNPTGSRSLQCNAEGKCQCKPGVTGDKCDACAPNHYEFTNQGCKPCGCNESGSYGNTPQCDPQTGVCLCKQNVEGRRCRECKPGFFNLDLQNEFGCTPCFCFGHSSQCSSAPKYQVHDISAHFIRDSEKWDAVDETGKPAQLQFNANTQNIAVVSKNTEIVYFLAPNQFLGDQRPSYNHDMKFSLKLGEHSGYPSAQDIILEGARTSISMNIYGQNNPEPTDQPQEYTFRLQEDPRYGWSPTLSNYEFMSILQNLTAIKIRGTYNKGGVGYLINFKLETAKIGREKGAAPANWVEKCSCPKAYVGDYCEECAPGFKHEPANGGPYSTCIPCDCNGHAHICDTATGFCICKHNTTGSNCELCAKGFYGNAIAGTPDDCKPCPCPKDSGCIQLMDQSIVCTDCPDGYAGPRCEVCADGHFGDPNGQFGPQKQCEECQCNGNVDLNAVGNCNRTTGECLKCIYNTAGQHCDKCLSGYYGDALDPKQKGDCQPCECHEGGTVESPEGPPLCDGLTGYCTCRPHVIGKNCDKCEDGYYNIFSGDGCKPCDCNLEGSYNSTCHPRTGQCYCKPGIDGKHCDRCRDYHYGFSVEGCKGCDCDEWGSTNYQCDVSGQCTCQENVEGRRCDSWNPELKPQRGPTMPSWRSGSASGNVRPSGSGTFRNTGNFRPQLNVPRQQINPPQRVSDVTMSHMNEEEKREITKICYQYRDIFYSENIPLSFTHTVKHELRLTDDTPIFVRSYRQAPQQRTEIQKQVDSLLKQGIIRESISPWSCPVHIVPKKPDASGKVKWRLVIDYRRLNDRIIEDKYPLPNINDILDRLGRAQYFTTIDLASGYHQLEMHPKDVEKTAFTTERGHYEFLRMPFGLKNAPSTFQRLMDHILRGIDNVFTYLDDVIIAATSLQNHNEKLKLVFQRFKMHNLKVQLDKSEFLQKHVNFLGHELTDQGLNPNKDKIKAVLNFPIPQTQKDIKAFLGLVGYYRKFIKDFAKLTKPLTACLKKNAKVEHTNEFLDAVDKCKQILTNAPILQYPDFDKPFILTTDASDFALGAVLSQGNVGSDKPVAYASRTLSDTEIRYSTIEKELLGIVWAIKYFRPYLYGRKFTIYTDHRPLTWLMSLKDPNSKLTRWKLKLAEYDYKVVYKKGKQNTNADALSRAKIFHNSIDSLAVNVDDNSDDNIINRIFENARRQAEVETNDPNNQDNERNNTDNDDQPYNNNDVEMTSIYPSQIDEETDTRSATTVDPDQLVSTNHTQPDNENNGIPIISDAIDRQLKQFYVRSTPGSTYRVEDRSTNSRTVIKDVFIPVNNTESEIIKFLKEHTIADRVFHCYFYDENLYLAFSRVYTTIFNDRGPKLIRCTSRVTLVENKTEQQELIKRYHEGKSSHRGIQETFKHLHRNYHWPNMLLTVQRFINQCDLCLKAKYERNPLKPPLIITETPTKPFQHLFMDLYSTGGATFLTIIDNFSKFAQAVPLNASSSVHIAEALLQVFSVLGLPLKITTDSDTKFDNDVIKEICASHDIHIHFTTPYNPNSNSPIERFHSTIAEIIRIQKMTNKDDPIQLIMKYAIIAYNNAIHSTTGYTPRELLFGHTASRNPLELYYPKEFYQDYVLNHRKNAEAVQECIAAHVSKNKEQVIEKRNQAAETITFKVGETVYKQVAKTTRSDKTKPVFKDKQNLTIIPKSKYLALGTNEYSYLEEDCKKITQDVQLCTSLNTQPVENSEDCIVTLIKHESTNCTRARMNLKQGKIQRLEDNKWLIILKDEQILKSRCGRKSDYKKMSGIYIASITSDCQVEIFNRTLKTNTDTITADEIVPIPSETTILEGNIRYNLQLKDISLDSIHELMDRVENIQQPIIDWQTMMTTPSWSTLGLYLILIAIIIWKLWQWRQRRLQSKNESPENTSTEDAAGSCGTRFYLKEGGVRQSPDALYIVATSRCMENKKRRLDGQGCEDCPPCYNLVLDAVNQHRRELQELDEILAKISKAPTVVENADFDNELQRVRAEIESLSQEAQIGLGNTGGSSLTDNLAELADRLADIRNMLFKIEDESFDGNEAVEKSKGNVSKAEGTIEAAQKEINSALEYLDGEGAAALAKARNRSDQFGKQSVDMSALAKESRLLAEKLENEARNIRDIADKAFNSSLVANKIAKDGINKQANISNEVQILTNELNAASGKLNSMTELADQALKRARAVYDEALGLYAEVNTTLLPDIKLNKLHEDSMEMNRTIDEKSAELDRLIAENEDTLHNLEDGIRRGRDLLEQGHDRQEELNDLLAKLDELQAQAKNDVELTKATLTAANEIYKTLKEFSDQVTESHKQAIQATMDVPAVQEKVAAAEESINSITEELVAASDKAKEARDLAQQAQKEYADKASEAAHEIKKKASAAKAKAVNLRDESDKLITRVRGTEKQIEELEKKAADNMQLTRDAKMKVGQANIDAREAEKQVTKGLEDLKVIMDELQNLPTLDDEALDRLKESLDSAEKALRGVDLDGKIKTLTEAKNNHQRWMKEYQDEHDLLRSEVENVKGILEQLPDGCFKRIVLEPTEGPSRSANYR

Description

Binding to cells via a high affinity receptor, laminin is thought to mediate the attachment, migration and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components.
During the formation of neuromuscular junctions at the larval stage, negatively regulates membrane protrusion from body wall muscles, probably downstream of the integrin complex formed by pat-2 and pat-3.
Binding to cells via a high affinity receptor, laminin is thought to mediate the attachment, migration and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. Activates presynaptic signaling involving integrin alpha-PS3/beta-nu and Fak to suppress neuromuscular junction (NMJ) growth during larval development and during low crawling activity, but not during higher-crawling conditions. Mediates, together with integrin alpha-PS3/beta-nu, glutamate receptor-modulated NMJ growth.
Netrins control guidance of CNS commissural axons and peripheral motor axons. Its association with either DCC or some UNC5 receptors will lead to axon attraction or repulsion, respectively. Binding to UNC5C might cause dissociation of UNC5C from polymerized TUBB3 in microtubules and thereby lead to increased microtubule dynamics and axon repulsion (By similarity). Involved in dorsal root ganglion axon projection towards the spinal cord (By similarity). It also serves as a survival factor via its association with its receptors which prevent the initiation of apoptosis. Involved in colorectal tumorigenesis by regulating apoptosis (By similarity).
Netrins control guidance of CNS commissural axons and peripheral motor axons. Its association with either DCC or some UNC5 receptors will lead to axon attraction or repulsion, respectively. Binding to UNC5C might cause dissociation of UNC5C from polymerized TUBB3 in microtubules and thereby lead to increased microtubule dynamics and axon repulsion (PubMed:28483977). Involved in dorsal root ganglion axon projection towards the spinal cord (PubMed:28483977). It also serves as a survival factor via its association with its receptors which prevent the initiation of apoptosis. Involved in colorectal tumorigenesis by regulating apoptosis (By similarity).
Netrins control guidance of CNS commissural axons and peripheral motor axons. Its association with either DCC or some UNC5 receptors will lead to axon attraction or repulsion, respectively. Binding to UNC5C might cause dissociation of UNC5C from polymerized TUBB3 in microtubules and thereby lead to increased microtubule dynamics and axon repulsion (PubMed:28483977). Involved in dorsal root ganglion axon projection towards the spinal cord (PubMed:28483977). It also serves as a survival factor via its association with its receptors which prevent the initiation of apoptosis. Involved in tumorigenesis by regulating apoptosis (PubMed:15343335).
Component of an extracellular matrix cue that guides dorsoventral migrations on the epidermis (PubMed:8861903). Required for the guidance of pioneer axons and migrating cells along the body wall (PubMed:8332188). During gonad morphogenesis, involved in distal tip cell (DTC) migration from the dorsal side of the hermaphrodite body to the midbody to allow for formation of gonad arms (PubMed:22732572). Its association with either unc-40 or unc-5 receptors will lead to axon attraction or repulsion, respectively (PubMed:8332188, PubMed:8861903). Involved in the positioning of ray 1, the most anterior ray sensilium, in the male tail (PubMed:24004945). Required for the formation of synapses between the AVA interneurons and the PHB sensory neurons (PubMed:29742100).
Netrins control guidance of CNS commissural axons at the midline and peripheral motor axons to their target muscles.
Laminin-5 is thought to be involved in (1) cell adhesion via integrin alpha-3/beta-1 in focal adhesion and integrin alpha-6/beta-4 in hemidesmosomes, (2) signal transduction via tyrosine phosphorylation of pp125-FAK and p80, (3) differentiation of keratinocytes.
Netrins control guidance of CNS commissural axons and peripheral motor axons.
Binding to cells via a high affinity receptor, laminin is thought to mediate the attachment, migration and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. Involved in the organization of the laminar architecture of the cerebral cortex (By similarity). It is probably required for the integrity of the basement membrane/glia limitans that serves as an anchor point for the endfeet of radial glial cells and as a physical barrier to migrating neurons (By similarity). Radial glial cells play a central role in cerebral cortical development, where they act both as the proliferative unit of the cerebral cortex and a scaffold for neurons migrating toward the pial surface (By similarity).
Binding to cells via a high affinity receptor, laminin is thought to mediate the attachment, migration and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. Involved in the organization of the laminar architecture of cerebral cortex. It is probably required for the integrity of the basement membrane/glia limitans that serves as an anchor point for the endfeet of radial glial cells and as a physical barrier to migrating neurons. Radial glial cells play a central role in cerebral cortical development, where they act both as the proliferative unit of the cerebral cortex and a scaffold for neurons migrating toward the pial surface.
Integral component of basement membranes. Component of the glomerular basement membrane (GBM), responsible for the fixed negative electrostatic membrane charge, and which provides a barrier which is both size- and charge-selective. It serves as an attachment substrate for cells. Plays essential roles in vascularization. Critical for normal heart development and for regulating the vascular response to injury. Also required for avascular cartilage development (By similarity).
Endorepellin in an anti-angiogenic and anti-tumor peptide that inhibits endothelial cell migration, collagen-induced endothelial tube morphogenesis and blood vessel growth in the chorioallantoic membrane. Blocks endothelial cell adhesion to fibronectin and type I collagen. Anti-tumor agent in neovascularization. Interaction with its ligand, integrin alpha2/beta1, is required for the anti-angiogenic properties. Evokes a reduction in phosphorylation of receptor tyrosine kinases via alpha2/beta1 integrin-mediated activation of the tyrosine phosphatase, PTPN6 (By similarity).
The LG3 peptide has anti-angiogenic properties that require binding of calcium ions for full activity.
Laminin-3 (S-laminin) regulates the formation of motor nerve terminals.
May play an important role in neural, kidney and vascular development.
May play an important role in neural, kidney and vascular development. Promotes neurite elongation from olfactory bulb explants.
Involved in hearing and vision as member of the USH2 complex. In the inner ear, required for the maintenance of the hair bundle ankle formation, which connects growing stereocilia in developing cochlear hair cells. In retina photoreceptors, the USH2 complex is required for the maintenance of periciliary membrane complex that seems to play a role in regulating intracellular protein transport.
Involved in hearing and vision as member of the USH2 complex. In the inner ear, required for the hair bundle ankle formation, which connects growing stereocilia in developing cochlear hair cells. In retina photoreceptors, the USH2 complex is required for the maintenance of periciliary membrane complex that seems to play a role in regulating intracellular protein transport.
Involved in hearing and vision as member of the USH2 complex (PubMed:20502675). In the inner ear, required for the maintenance of hair bundle ankle formation, which connects growing stereocilia in developing cochlear hair cells (PubMed:20502675, PubMed:24334608). In retina photoreceptors, the USH2 complex is required for the maintenance of periciliary membrane complex that seems to play a role in regulating intracellular protein transport (PubMed:20502675).
Involved in controlling patterning and neuronal circuit formation at the laminar, cellular, subcellular and synaptic levels. Promotes neurite outgrowth of both axons and dendrites.
Netrins control guidance of CNS commissural axons and peripheral motor axons (PubMed:8780645, PubMed:8780646, PubMed:11719202). Its association with either fra or unc-5 receptors will lead to axon attraction or repulsion, respectively (PubMed:11719202). While short-range repulsion requires both fra and unc-5 receptors, long-range repulsion only requires unc-5 (PubMed:11719202).

Subunit

Laminin is a complex glycoprotein, consisting of three different polypeptide chains (alpha, beta, gamma), which are bound to each other by disulfide bonds into a cross-shaped molecule comprising one long and three short arms with globules at each end.
Laminin is a complex glycoprotein, consisting of three different polypeptide chains (alpha, beta, gamma), which are bound to each other by disulfide bonds into a cross-shaped molecule comprising one long and three short arms with globules at each end. Gamma-1 is a subunit of laminin-1 (laminin-111 or EHS laminin), laminin-2 (laminin-211 or merosin), laminin-3 (laminin-121 or S-laminin), laminin-4 (laminin-221 or S-merosin), laminin-6 (laminin-311 or K-laminin), laminin-7 (laminin-321 or KS-laminin), laminin-8 (laminin-411), laminin-9 (laminin-421), laminin-10 (laminin-511) and laminin-11 (laminin-521).
Laminin is a complex glycoprotein, consisting of three different polypeptide chains (alpha, beta, gamma), which are bound to each other by disulfide bonds into a cross-shaped molecule comprising one long and three short arms with globules at each end. Gamma-3 is a subunit of laminin-12 (laminin-213), laminin-14 (laminin-423) and laminin-15 (laminin-523).
Laminin is a complex glycoprotein, consisting of three different polypeptide chains (alpha, beta, gamma), which are bound to each other by disulfide bonds into a cross-shaped molecule comprising one long and three short arms with globules at each end. Alpha-1 is a subunit of laminin-1 (laminin-111 or EHS laminin) and laminin-3 (laminin-121 or S-laminin).
Laminin is a complex glycoprotein, consisting of three different polypeptide chains (alpha, beta, gamma), which are bound to each other by disulfide bonds into a cross-shaped molecule comprising one long and three short arms with globules at each end. Alpha-2 is a subunit of laminin-2 (laminin-211 or merosin), laminin-4 (laminin-221 or S-merosin) and laminin-12 (laminin-213). Interacts with FBLN1, FBLN2 and NID2.
Laminin is a complex glycoprotein, consisting of three different polypeptide chains (alpha, beta, gamma), which are bound to each other by disulfide bonds into a cross-shaped molecule comprising one long and three short arms with globules at each end. Alpha-5 is a subunit of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523).
Binds to its receptors; DCC, UNC5A, UNC5B, UNC5C and probably UNC5D. Binds to its receptor; DSCAM (By similarity). Interacts with APP (By similarity).
Binds to its receptors; DCC, UNC5A, UNC5B, UNC5C and probably UNC5D (By similarity). Binds to its receptor; DSCAM (PubMed:18585357). Interacts with APP (PubMed:27068745).
Binds to its receptors; DCC, UNC5A, UNC5B, UNC5C and probably UNC5D (PubMed:9950216). Binds to its receptor; DSCAM (PubMed:19196994). Interacts with APP (By similarity).
Binds to unc-5 and unc-40 receptors.
Laminin is a complex glycoprotein, consisting of three different polypeptide chains (alpha, beta, gamma), which are bound to each other by disulfide bonds into a cross-shaped molecule comprising one long and three short arms with globules at each end. Alpha-3 is a subunit of laminin-5 (laminin-332 or epiligrin/kalinin/nicein), laminin-6 (laminin-311 or K-laminin) and laminin-7 (laminin-321 or KS-laminin).
Laminin is a complex glycoprotein, consisting of three different polypeptide chains (alpha, beta, gamma), which are bound to each other by disulfide bonds into a cross-shaped molecule comprising one long and three short arms with globules at each end. Beta-1 is a subunit of laminin-1 (laminin-111 or EHS laminin), laminin-2 (laminin-211 or merosin), laminin-6 (laminin-311 or K-laminin), laminin-8 (laminin-411), laminin-10 (laminin-511) and laminin-12 (laminin-213).
Purified perlecan has a strong tendency to aggregate in dimers or stellate structures. It interacts with other basement membrane components such as laminin, prolargin and collagen type IV. Interacts with COL13A1, FGFBP1 and VWA1. Interacts (via C-terminus) with ECM1 (via C-terminus).
Purified perlecan has a strong tendency to aggregate in dimers or stellate structures. It interacts with other basement membrane components such as laminin, prolargin and collagen type IV. Interacts with COL13A1, FGFBP1 and VWA1. Interacts (via C-terminus) with ECM1 (via C-terminus) (By similarity).
Laminin is a complex glycoprotein, consisting of three different polypeptide chains (alpha, beta, gamma), which are bound to each other by disulfide bonds into a cross-shaped molecule comprising one long and three short arms with globules at each end. Beta-2 is a subunit of laminin-3 (laminin-121 or S-laminin), laminin-4 (laminin-221 or S-merosin), laminin-7 (laminin-321 or KS-laminin), laminin-9 (laminin-421), laminin-11 (laminin-521), laminin-14 (laminin-423) and laminin-15 (laminin-523).
May form a homodimer.
Laminin is a complex glycoprotein, consisting of three different polypeptide chains (alpha, beta, gamma), which are bound to each other by disulfide bonds into a cross-shaped molecule comprising one long and three short arms with globules at each end. Beta-3 is a subunit of laminin-5 (laminin-332 or epiligrin/kalinin/nicein). Interacts with ECM1.
Interacts with collagen IV and fibronectin via its laminin EGF-like domains. Interaction with collagen may be required for stable integration into the basement membrane (PubMed:14676276, PubMed:16114888). Interacts with NINL (PubMed:18826961). Interacts with USH1C (PubMed:16301216). Component of USH2 complex, composed of ADGRV1, PDZD7, USH2A and WHRN. Interacts with ADGRV1/MASS1 (via N-terminal PDZ domain). Interacts (via the cytoplasmic region) with WHRN (PubMed:16434480). Interacts (via the cytoplasmic region) with PDZD7 (PubMed:20440071). Interacts (via the cytoplasmic region) with VEZT and MYO7A (via MyTH4-FERM domains); the interaction associates VEZT with the USH2 complex at the stereocilia base (By similarity).
Laminin is a complex glycoprotein, consisting of three different polypeptide chains (alpha, beta, gamma), which are bound to each other by disulfide bonds into a cross-shaped molecule comprising one long and three short arms with globules at each end. Beta-3 is a subunit of laminin-5 (laminin-332 or epiligrin/kalinin/nicein). Interacts with ECM1 (By similarity).
Interacts with collagen IV and fibronectin via its laminin EGF-like domains. Interaction with collagen may be required for stable integration into the basement membrane. Interacts with NINL (By similarity). Interacts with USH1C. Interacts (via the cytoplasmic region) with PDZD7. Component of USH2 complex, composed of ADGRV1, PDZD7, USH2A and WHRN. Interacts with ADGRV1/MASS1 (via N-terminal PDZ domain). Interacts (via the cytoplasmic region) with WHRN. Interacts (via the cytoplasmic region) with VEZT and MYO7A (via MyTH4-FERM domains); the interaction associates VEZT with the USH2 complex at the stereocilia base (By similarity).
Interacts with collagen IV and fibronectin via its laminin EGF-like domains. Interaction with collagen may be required for stable integration into the basement membrane. Interacts with NINL (By similarity). Interacts with USH1C (PubMed:16301217). Component of USH2 complex, composed of ADGRV1, PDZD7, USH2A and WHRN (PubMed:20502675, PubMed:25406310). Interacts with ADGRV1/MASS1 (via N-terminal PDZ domain) (PubMed:20502675). Interacts (via the cytoplasmic region) with WHRN (PubMed:16301217, PubMed:20502675, PubMed:23055499). Interacts (via the cytoplasmic region) with PDZD7 (PubMed:23055499). Interacts (via the cytoplasmic region) with VEZT and MYO7A (via MyTH4-FERM domains); the interaction associates VEZT with the USH2 complex at the stereocilia base (PubMed:17567809).
Interacts with NGL1.
Laminin is a complex glycoprotein, consisting of three different polypeptide chains (alpha, beta, gamma), which are bound to each other by disulfide bonds into a cross-shaped molecule comprising one long and three short arms with globules at each end. Beta-1 is a subunit of laminin-1 (laminin-111 or EHS laminin), laminin-2 (laminin-211 or merosin), laminin-6 (laminin-311 or K-laminin), laminin-8 (laminin-411), laminin-10 (laminin-511) and laminin-12 (laminin-213) (By similarity).
Interacts with LRRC4.
Binds to unc-5 and fra receptors.

Miscellaneous

The LG3 peptide has been found in the urine of patients with end-stage renal disease and in the amniotic fluid of pregnant women with premature rupture of fetal membranes.

Keywords

Basement membrane   Cell adhesion   Coiled coil   Complete proteome   Disulfide bond   Extracellular matrix   Glycoprotein   Laminin EGF-like domain   Reference proteome   Repeat   Secreted   Signal   3D-structure   Phosphoprotein   Polymorphism   Disease mutation   Direct protein sequencing   Pyrrolidone carboxylic acid   Congenital muscular dystrophy   Limb-girdle muscular dystrophy   Cell junction   Cell projection   Cytoplasmic vesicle   Synapse   Alternative splicing   Apoptosis   Neurogenesis   Developmental protein   Differentiation   Epidermolysis bullosa   Lissencephaly   Angiogenesis   Calcium   EGF-like domain   Heparan sulfate   Immunoglobulin domain   Metal-binding   Proteoglycan   Amelogenesis imperfecta   Cell membrane   Deafness   Hearing   Membrane   Retinitis pigmentosa   Sensory transduction   Transmembrane   Transmembrane helix   Usher syndrome   Vision   GPI-anchor   Lipoprotein   Cytoplasm  

Feature

chain  Laminin subunit gamma-1
sequence variant  Found in a consanguineous family with intellectual disability; unknown pathological significance.
splice variant  In isoform 2.
propeptide  Removed in mature form

Uniprot

P15215.2   P02468.2   P11047.3   A0JP86.1   Q18823.3   Q1LVF0.2   + More
Q9Y6N6.3   Q9R0B6.2   P19137.2   P25391.2   Q60675.2   P24043.4   Q00174.2   Q61001.4   Q21313.1   Q90922.1   O15230.8   Q924Z9.1   O09118.3   O95631.2   Q2HXW4.1   Q90923.1   P34710.1   P11046.4   Q24567.2   Q61789.4   Q9R1A3.1   O00634.1   Q16787.2   P02469.3   P07942.2   A4D0S4.1   P98160.4   Q05793.1   P15800.1   P55268.2   Q61292.2   Q5RB89.1   Q9HB63.2   Q8JHV6.1   Q13751.1   Q9JI33.2   O75445.3   Q61087.2   Q8K3K1.2   Q2QI47.2   Q9Y2I2.3   Q8R4G0.2   Q01635.1   Q96CW9.2   Q24568.1  

Pubmed

2912972    2808533    1840513    10731132    12537572    3405777    + More
3680290    3167041    2836421    6209134    19349973    21183079    8648630    8648631    3360804    1985895    16710414    1806043    3234037    12754519    16335952    19159218    21269460    21406692    22905912    24275569    26091039    16959974    28397838    9851916    12754521    15888633    16495308    17761667    12070089    23594743    10225960    15164053    21572413    19468303    15489334    10318827    3182802    3267223    3181157    11829758    8354280    1714537    16177791    2049067    2733383    25105227    25171405    7795883    8345183    7874173    10022829    10619025    8294519    8910357    14574404    7535762    2185464    21953594    24957499    24611677    11591858    12552556    27234031    1425586    8223265    1744083    17893096    23054837    7499364    8062384    11821406    11780052    11572484    9628581    9271224    10964957    19690332    11356879    8861902    8978605    10381568    7604039    18585357    27068745    28483977    9950216    16625196    20736409    15343335    19196994    1329863    8332188    8861903    22732572    24004945    29742100    8397815    3365769    12537569    8780645    8780646    7665604    9151674    8012114    10366627    16141072    11231084    8828041    9143507    12915477    15044476    8586427    8077230    8530087    7633458    3493487    9219532    23472759    1975589    3611077    12690205    3661559    12853948    14702039    25787250    1569102    1730768    8234307    11101850    1685141    1679749    2687294    15591058    12435733    11148217    11279527    11956183    12604605    17105986    18024432    19789387    22171320    21996443    1744087    2972708    7649154    10545953    16407285    18694874    19656770    11427896    2922051    24090084    7698745    7795887    15367484    16912710    20798252    21236492    8662701    8043959    7885444    11038171    17974005    7512558    7774918    8530036    11296269    19275936    23958762    23632796    7550237    9767254    17476356    10940631    9624053    10729113    15015129    11788194    12433396    14676276    16114888    16301217    16301216    16434480    12786748    18826961    20440071    10775529    10909849    10738000    11311042    12427073    12112664    12525556    15025721    14970843    15325563    15241801    16098008    17085681    17296898    17405132    18452394    18273898    19737284    19683999    20507924    20309401    21835308    21593743    21686329    21248752    22004887    22334370    24227914    23737954    25388789    26377068    28281779    7898049    12160733    15057822    17567809    20502675    23055499    24334608    25406310    10231032    12975309    15340161    14595443    15901489    21946559    10964959    11906208    15368895    11804778    1400373    11347906    12168954    22041449    11719202    29513217   

EMBL

M58417    M25063    AE014296    BT021394    X05211    J03484    + More
J02930    J03749    J03202    M55210    M55217    M55201    M55211    M55212    M55213    M55214    M55215    M55216    M55192    M55193    M55194    M55195    M55196    M55197    M55198    M55199    M55200    M55202    M55203    M55204    M55205    M55206    M55207    M55208    M55209    AL354953    AL450304    X13939    M27654    BC127297    FO080795    AF468048    BX681417    BX571812    AF041835    AL355872    AL583807    AB208887    AF083372    AL928893    BX511243    CH466542    BC096366    AF079520    J04064    AC154823    X07737    X13459    M36775    AP002409    AP005062    AP005210    X58531    U12147    AC101709    AC152982    AC153800    AC155942    AC167232    AC171406    X69869    S75315    Z26653    U66796    U66733    U66734    U66735    U66736    U66737    U66738    U66739    U66740    U66741    U66742    U66743    U66745    U66746    U66747    U66748    U66749    U66750    U66751    U66752    U66753    U66754    U66755    U66756    U66757    U66758    U66759    U66760    U66761    U66762    U66763    U66764    U66765    U66766    U66768    U66769    U66770    U66771    U66772    U66773    U66774    U66775    U66776    U66777    U66778    U66779    U66780    U66781    U66782    U66783    U66784    U66785    U66786    U66787    U66788    U66789    U66790    U66791    U66792    U66793    U66794    U66795    AL583853    AL356124    AL445439    AL513527    AL590613    AL669984    AL589927    M59832    M96388    L07288    M75882    AL663027    AJ293593    U37501    Z70286    L34549    AF443072    AL354836    BC085017    AB067494    AB011105    Z95636    AY028417    U65418    AF128865    AL606831    AL662894    AL669842    CH466601    BC141294    U23505    U75586    GU727649    AC090610    AC005695    DQ368597    L34550    M80241    FO080932    M95811    M19525    AE014134    BT015222    AY095001    U60316    U63736    AE014298    AY089580    X84013    X84014    AC102131    AC102248    AC139027    AC157909    AJ293592    U88353    L20478    AF152418    AK031199    AF149094    AF128866    U86759    U86758    AY327114    AY327115    AY327116    AB107369    EF444992    AC010754    AC067796    AC090366    X85107    X85108    X84900    L34155    M15525    CR974423    CT571245    X05212    M61951    M58147    M61917    M61918    M61921    M61922    M61923    M61924    M61925    M61926    M61927    M61928    M61929    M61930    M61931    M61932    M61933    M61934    M61935    M61936    M61938    M61939    M61940    M61941    M61942    M61943    M61944    M61945    M61946    M61947    M61948    M61949    M61950    M55370    M55378    M55365    M55371    M55372    M55373    M55374    M55375    M55376    M55344    M55345    M55346    M55347    M55348    M55349    M55350    M55351    M55352    M55353    M55355    M55356    M55357    M55358    M55359    M55360    M55361    M55362    M55363    M55364    M55366    M55367    M55368    M55369    M61916    CH236947    BC113455    M20206    AF028816    AC005048    BC045172    BC140804    BC142619    AK075165    M85289    X62515    AL590556    AL590103    L22078    AL445795    S76436    M64283    M77174    J04054    J04055    X16563    Z68155    Z68156    X79683    S77512    U43541    U42624    CH466560    BC026051    X75928    CR858764    CR859277    AF278532    AF297711    AF119916    AY330211    AL137540    CH471054    BC013591    BC136798    BC136799    AL833767    AK024691    AF468050    L25541    U17760    U17745    U17746    U17747    U17748    U17749    U17750    U17751    U17752    U17753    U17754    U17755    U17756    U17757    U17758    U17759    D37766    AY035783    AL023754    AL031316    CH471100    BC075838    AF268066    AF281278    AC124585    AC151976    AF055580    AF091889    AF091873    AF091875    AF091876    AF091874    AF091877    AF091879    AF091881    AF091883    AF091888    AF091887    AF091886    AF091885    AF091884    AF091882    AF091880    AF091878    AY481573    AC092799    AC093581    AC119429    AC138024    AL139259    AL358452    AL358858    AL445650    AL513305    U43298    AK155769    CH466555    BC008516    AY077844    AABR07022087    AABR07022096    AABR07022088    AABR07022089    AABR07022090    AABR07022091    AABR07022092    AABR07022094    AABR07022093    AABR07022095    AF151717    DQ073638    AC121799    AC121892    AC122122    AC129312    AC135863    AC165230    AB023193    AY358365    BX538348    AC114491    AL513187    AL590427    BC030220    AB038662    AB038663    AB038664    AB038665    AB038666    AB038667    AF475069    AF475070    AF475071    AF475072    AF475073    AF475074    AF475075    AF475076    AF475077    AF475078    AK034465    AK173075    BC079881    BAB12010.1    L00962    AB058760    AY358165    AL353631    AL159997    BC013770    AAH13770.1    BAB47486.2    U60317    U63737   

Proteomes

UP000000803    UP000000589    UP000005640    UP000008143    UP000001940    UP000000437    + More
UP000000539    UP000002494    UP000008227    UP000001595   

PRIDE

P15215    P02468    P11047    A0JP86    Q18823    Q1LVF0    + More
Q9Y6N6    Q9R0B6    P19137    P25391    Q60675    P24043    Q00174    Q61001    Q21313    O15230    Q924Z9    O09118    O95631    Q2HXW4    Q90923    P34710    P11046    Q24567    Q61789    Q9R1A3    O00634    Q16787    P02469    P07942    A4D0S4    P98160    Q05793    P15800    P55268    Q61292    Q9HB63    Q8JHV6    Q13751    Q9JI33    O75445    Q61087    Q8K3K1    Q2QI47    Q9Y2I2    Q8R4G0    Q96CW9    Q24568   

Pfam

PF00055   Laminin_N        + More
PF00052   Laminin_B
PF00053   Laminin_EGF
PF00054   Laminin_G_1
PF02210   Laminin_G_2
PF06009   Laminin_II
PF06008   Laminin_I
PF01759   NTR
PF13895   Ig_2
PF07679   I-set
PF00057   Ldl_recept_a
PF00008   EGF
PF00041   fn3

Interpro

IPR000742   EGF-like_dom        + More
IPR008211   Laminin_N       
IPR038684   Laminin_N_sf       
IPR002049   Laminin_EGF       
IPR000034   Laminin_IV       
IPR011641   Tyr-kin_ephrin_A/B_rcpt-like       
IPR013320   ConA-like_dom_sf       
IPR009254   Laminin_aI       
IPR013032   EGF-like_CS       
IPR010307   Laminin_dom_II       
IPR001791   Laminin_G       
IPR009030   Growth_fac_rcpt_cys_sf       
IPR008979   Galactose-bd-like_sf       
IPR008993   TIMP-like_OB-fold       
IPR001134   Netrin_domain       
IPR018933   Netrin_module_non-TIMP       
IPR001368   TNFR/NGFR_Cys_rich_reg       
IPR013015   Laminin_IV_B       
IPR013106   Ig_V-set       
IPR023415   LDLR_class-A_CS       
IPR003598   Ig_sub2       
IPR036179   Ig-like_dom_sf       
IPR000082   SEA_dom       
IPR003599   Ig_sub       
IPR007110   Ig-like_dom       
IPR013783   Ig-like_fold       
IPR001881   EGF-like_Ca-bd_dom       
IPR036055   LDL_receptor-like_sf       
IPR013098   Ig_I-set       
IPR002172   LDrepeatLR_classA_rpt       
IPR035811   Netrin-4_NTR       
IPR036116   FN3_sf       
IPR003961   FN3_dom       
IPR006558   LamG-like       
IPR026915   USH2A       

SUPFAM

SSF49899   SSF49899        + More
SSF57184   SSF57184       
SSF49785   SSF49785       
SSF50242   SSF50242       
SSF48726   SSF48726       
SSF57424   SSF57424       
SSF49265   SSF49265       

Gene 3D

2.60.120.1490     2.60.120.260     2.60.40.10     4.10.400.10    

CDD

cd00112  LDLa
cd03578  NTR_netrin-4_like
cd00063  FN3

ProteinModelPortal

P15215.2   P02468.2   P11047.3   A0JP86.1   Q18823.3   Q1LVF0.2   + More
Q9Y6N6.3   Q9R0B6.2   P19137.2   P25391.2   Q60675.2   P24043.4   Q00174.2   Q61001.4   Q21313.1   Q90922.1   O15230.8   Q924Z9.1   O09118.3   O95631.2   Q2HXW4.1   Q90923.1   P34710.1   P11046.4   Q24567.2   Q61789.4   Q9R1A3.1   O00634.1   Q16787.2   P02469.3   P07942.2   A4D0S4.1   P98160.4   Q05793.1   P15800.1   P55268.2   Q61292.2   Q5RB89.1   Q9HB63.2   Q8JHV6.1   Q13751.1   Q9JI33.2   O75445.3   Q61087.2   Q8K3K1.2   Q2QI47.2   Q9Y2I2.3   Q8R4G0.2   Q01635.1   Q96CW9.2   Q24568.1  

PDB

4AQT     E-value=2.08356e-119,     Score=1106

KEGG

101746961    K05635 laminin, gamma 1 | (RefSeq) laminin subunit gamma-1

PATHWAY

04512    ECM-receptor interaction - Bombyx mori (domestic silkworm)

GO

GO:0061031   GO:0085029   GO:0007435   GO:0005604   GO:0071711   GO:0034446   GO:0033627   GO:0070831   GO:0007494   GO:0043208   GO:0005606   GO:0022617   GO:0065003   GO:0062023   GO:0031594   GO:0009888   GO:0016477   GO:0031012   GO:0007155   GO:0031175   GO:0043083   GO:0009887   GO:0043259   GO:0005615   GO:0031581   GO:0005201   GO:0005576   GO:0043687   GO:0043260   GO:0030198   GO:0007492   GO:0005788   GO:0050679   GO:0070062   GO:0044267   GO:0040017   GO:0007519   GO:0030903   GO:0007420   GO:0048570   GO:0050908   GO:0001654   GO:0031290   GO:0061053   GO:0007411   GO:0048854   GO:0007634   GO:0007517   GO:0007601   GO:0014002   GO:0016020   GO:0005198   GO:0060041   GO:0000904   GO:0043256   GO:0005911   GO:0002011   GO:0005608   GO:0005102   GO:0043010   GO:0008022   GO:0060441   GO:0061304   GO:0048514   GO:0007166   GO:0006468   GO:0030155   GO:0045995   GO:0030334   GO:0060445   GO:0045198   GO:0042383   GO:0032224   GO:0043197   GO:0014037   GO:0007507   GO:0036062   GO:0045886   GO:0030424   GO:0007498   GO:0008021   GO:0016321   GO:0035011   GO:0035001   GO:0030054   GO:0016331   GO:0001755   GO:0030324   GO:0048754   GO:0072659   GO:0042475   GO:0001658   GO:0060271   GO:0005610   GO:0001942   GO:0005178   GO:0098609   GO:0042127   GO:0007229   GO:0001738   GO:0009408   GO:0000003   GO:0001764   GO:0010950   GO:0007414   GO:0051788   GO:0008045   GO:0032488   GO:0016358   GO:0006930   GO:0071944   GO:0045773   GO:0007265   GO:2000147   GO:0045446   GO:0008037   GO:0001525   GO:0005634   GO:0008283   GO:0030154   GO:0048041   GO:0019221   GO:0007010   GO:0061643   GO:0006915   GO:0007409   GO:0030879   GO:0042472   GO:0033564   GO:0060603   GO:0051963   GO:0008284   GO:0005737   GO:0030517   GO:0007097   GO:1902842   GO:0006355   GO:0007520   GO:0038007   GO:0035262   GO:0033563   GO:0008078   GO:0007419   GO:0045138   GO:1905489   GO:1905488   GO:1905812   GO:0097374   GO:0097376   GO:0051965   GO:1905815   GO:0045089   GO:0003143   GO:0050829   GO:0008406   GO:0055013   GO:0048513   GO:0048749   GO:0005829   GO:0008347   GO:2000289   GO:0070983   GO:0044295   GO:0035987   GO:0005783   GO:0005913   GO:0030056   GO:0005794   GO:0008544   GO:0007162   GO:0007566   GO:0042476   GO:0043257   GO:0021812   GO:0030335   GO:0019899   GO:0005607   GO:0007611   GO:0048471   GO:0030021   GO:0050750   GO:0006629   GO:0005509   GO:0005886   GO:0043202   GO:0001523   GO:0006954   GO:0006027   GO:0005925   GO:0006898   GO:0006024   GO:0060548   GO:0098797   GO:0001540   GO:0072358   GO:0016525   GO:1905907   GO:0005796   GO:0002062   GO:0048738   GO:0001958   GO:0008104   GO:0060351   GO:0002020   GO:0048704   GO:0072274   GO:0007528   GO:0014044   GO:0072249   GO:0048677   GO:0045202   GO:0050808   GO:0060668   GO:0016322   GO:0043237   GO:0044877   GO:0050873   GO:0017022   GO:0032421   GO:0060171   GO:0001917   GO:0050953   GO:1990075   GO:0043025   GO:0032391   GO:0016324   GO:0016021   GO:0036064   GO:0035315   GO:0005518   GO:0002141   GO:0002142   GO:0045494   GO:0048496   GO:1990696   GO:0042803   GO:0022008   GO:0043195   GO:0007605   GO:0050896   GO:0045184   GO:0060113   GO:0032420   GO:0098632   GO:0050804   GO:0050839   GO:0098978   GO:0099029   GO:0099560   GO:0046658   GO:0098685   GO:0005623   GO:1905606   GO:0098698   GO:0045171   GO:0090543   GO:0007432   GO:0016200   GO:0008039   GO:0005515   GO:0015074   GO:0003676   GO:0005200   GO:0005525   GO:0048013   GO:0005003   GO:0005887   GO:0007169  

PANTHER

PTHR10574:SF274  

Subcellular location

  
Secreted  
Extracellular space  
Extracellular matrix  
Basement membrane  
Cell junction  
Synapse  
Cell projection  
Axon  
Cytoplasmic vesicle  
Secretory vesicle  
Synaptic vesicle  
Stereocilium membrane   Component of the interstereocilia ankle links in the inner ear sensory cells. In photoreceptors, localizes at a plasma membrane microdomain in the apical inner segment taht surrounds the connecting cilia called periciliary membrane complex.   With evidence from 3 publications.
Photoreceptor inner segment   Component of the interstereocilia ankle links in the inner ear sensory cells. In photoreceptors, localizes at a plasma membrane microdomain in the apical inner segment taht surrounds the connecting cilia called periciliary membrane complex.   With evidence from 3 publications.
Cell membrane  
Cytoplasm   Expressed in the perinuclear region of the oldest most anterior lamina neurons at 24 hours after puparium formation.   With evidence from 6 publications.
Perinuclear region   Expressed in the perinuclear region of the oldest most anterior lamina neurons at 24 hours after puparium formation.   With evidence from 6 publications.

SignalP

Position:   1 - 19,         Likelihood:  0.985436

 

 

Length:

2937

Number of predicted TMHs:

0

Exp number of AAs in TMHs:

8.17123999999996

Exp number, first 60 AAs:

5.35859

Total prob of N-in:

0.27912

outside

1  -  2937

 

 

Pi

3.011653

Theta

31.931747

Tajima's D

-1.777824

CLR

0.010163

CSRT

0.0306984650767462

Interpretation

Uncertain