SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00075
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.432
 

Sequence

CDS
ATGATTACACCAATTATTCAAAATCAACACTGTCGGTCCGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGATACCGTCGAATCCATAAACATCTTCACTGATCACGTCTCGACGGCGATCATAAGATCCTCGAAACAAGTTGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGAACTTAGGGACCTCGTTAGAATTAGAAACGCGGCAATCCGGGCCTACGATCGATATCCCACGGATTCAAACCGGACTCGGATGCGTCGCTTACAGCGGGAGGTCAAATCCCGCTTAAGCGACGCCCGAAACGAAAACTGGGATAGTTATTTAGAAGAACTCGCGCCCACTCACCAAGCATACTGGCAACTAGCTAGGACCCTCAAGTCCGAAACTATAGCCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAACCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTCAAGGAGGCGATCGATAGCCTACAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAATTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATATTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAACAAAATTCTGATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGGCTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCTCTCTCCCCGTTACTATTTAGTTTGTATATCAACGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGAGGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCGGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATTAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCCCTCCCGACTAGGCGCGTCAATACCCCCGCCCCCGCCGTTCGCCCAATCACGATGTTCGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATCAAGACGGTACGCGATCGTGCCGCCTTCATTCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCACTCACTTAAAGTCATTCCAAATTATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTGCAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGACCCGCCCGATCCACTAACGGTGGATCGGGCTTTTAGACTTCGCCAAGACTACACTATAGACAAATGA
Protein
MITPIIQNQHCRSVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESINIFTDHVSTAIIRSSKQVDVEDCFHRIRLSPELRDLVRIRNAAIRAYDRYPTDSNRTRMRRLQREVKSRLSDARNENWDSYLEELAPTHQAYWQLARTLKSETIATMPPLVRPSGQPPAYDDDDKAELLADALQEQCTTSTQHADPEHTEFVDREVERRASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFAEDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNTPAPAVRPITMFDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVDRAFRLRQDYTIDK

Summary

EMBL
AB018558    BAA76304.1    U07847    AAA17752.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    GALX01005359    JAB63107.1    GGMR01019198    MBY31817.1    ABLF02029306    ABLF02029314    ABLF02060138    S59870    AAB26437.2    RPOV01000134    RPJ78669.1    GFTR01008038    JAW08388.1    GBBI01004395    JAC14317.1    GBBI01004571    JAC14141.1    ABLF02042518    ABLF02057746    GGMS01006359    MBY75562.1    GGMR01018716    MBY31335.1    GFXV01007093    MBW18898.1    NEVH01006736    PNF36716.1    ABLF02033757    NEVH01006721    PNF37225.1    GGFJ01002256    MBW51397.1    GGMS01002992    MBY72195.1    GGFJ01002257    MBW51398.1    GEZM01053022    JAV74219.1    NEVH01026386    PNF14434.1    GGFJ01001842    MBW50983.1    GGMR01003407    MBY16026.1    GGFJ01001843    MBW50984.1    GGFJ01001844    MBW50985.1    GBBI01001646    JAC17066.1    ABLF02024246    GGMS01002955    MBY72158.1    NEVH01020940    PNF20481.1    ABLF02008463    JRES01000644    KNC29657.1    GGMR01012305    MBY24924.1    GGFL01005012    MBW69190.1    GGFL01004957    MBW69135.1    GGMR01000005    MBY12624.1    KK119692    KFM76444.1    GGFJ01001858    MBW50999.1    GFDF01007661    JAV06423.1    ABLF02008153    ABLF02008462    ABLF02008464    NEVH01000269    PNF43694.1    GGFJ01001857    MBW50998.1    NEVH01005938    PNF38077.1    NEVH01016302    PNF25823.1    NEVH01003017    PNF40781.1    GFTR01008271    JAW08155.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01007443    PNF35684.1    GBYB01008290    JAG78057.1    NEVH01018383    PNF23463.1    GGMR01000676    MBY13295.1    GGMS01004444    MBY73647.1    LBMM01014395    KMQ85192.1    GFTR01008262    JAW08164.1    NEVH01010546    PNF32261.1    NEVH01017542    PNF24034.1    NEVH01023962    PNF17612.1    NEVH01020071    PNF21969.1    GEZM01084969    JAV60363.1    ABLF02034467    NEVH01022639    PNF18527.1    NEVH01019964    PNF22161.1    NEVH01001355    PNF42855.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    KQ973363    EFA13335.2    NEVH01023961    PNF17613.1    NEVH01007838    PNF34986.1    GFTR01008251    JAW08175.1    GEDC01000337    JAS36961.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.00697531,     Score=95

Ontologies

Topology

Length:
724
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.725799999999998
Exp number, first 60 AAs:
0
Total prob of N-in:
0.02005
outside
1  -  724
 
 

Population Genetic Test Statistics

Pi
2.723148
Theta
18.234108
Tajima's D
-0.98333
CLR
0
CSRT
0.134793260336983
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号