SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00069
Pre Gene Modal
BGIBMGA007461
Annotation
PREDICTED:_glucose_transporter_type_1-like_[Bombyx_mori]
Full name
Glucose transporter type 1      
Location in the cell
PlasmaMembrane   Reliability : 4.892
 

Sequence

CDS
ATGTTGGGAGTCCTCAACAGAGCGAAGCGGTATTTCAGGCCTGGACAGAGACTTGCGCTTTATAAAGCGCAGGTCCGACCTCGCCTGGAGTACTGCTCTTACCTCTGGGCCGGGGCTCCCAAATACCAGCTACTTCCATTTGACTCCATACAGAAACGGGCTATTCGGATGGTCGATAGTCCTGCTCTCGCGGATCGCTTGGAACCTCTGGGTCTACGGAGGGACTTCGGTTCTCTCTGTGTTTTATACCGCATGGTCAAACGCGACATGGTGGCCATCAAGCAAGAGCTGGATACGGTGCAACAGGTGAAGGAAGAGATCGAAGAACTGCGAGAATATGTCGACAGACTTGAGGAACACACTCAACGAAGAAAACTCAGGCTGCTCGAACAGGGCCTCACATTCTTCCTGTCATACGCTATCCTAGCGGCGGTGTTGGGGATGCTGCAATTCGGATACAACACCGGCGTAATCAACGCTCCTAGCAAAAACATCGCAAACTTCATGAAGGACGTTTATAAGAAGAGATACGGCATAGATTTGCACGACGGCACCGTCAACTCATTGTTCTCGATAGCGGTCAGCATCTTCGCTATCGGGGGAATGCTCGGGGGTTTCTCGGGTGGCATGATTGCCAACCGTTTCGGAAGGAAAGGAGGATTATTGCTCAATAACATTCTCGGTATAAGCGGCGCGAGTCTCATGGGCTTTACCAAGATCTCACATTGCTACGAATTGCTCATCTTCGGCAGATTTATTATAGGTGTCAATTGCGGTTTGAACACATCCTTAGTGCCAATGTACATATCGGAAATCGCTCCGCTGAATCTCAGAGGCGGTCTGGGAACTGTCAACCAACTAGCCGTTACCGTTGGTTTACTCATATCGCAGGTTCTAGGCATCGAACAGATTCTTGGTACAGACGAAGGATGGCCGATTTTACTAGGTCTTGCGATATGCCCAGCTATATTACAACTCCTCCTACTCCCGGCTTGCCCTGAATCCCCTAGATATTTACTCATCACCCGCCAATGGGAAGAAGAAGCGAGGCGTGCCCTAAGGAGACTACGAGCTAGTAATCAGGTCGAAGAGGATATTGAGGAAATGAGAGCAGAAGAACGAGCACAGCAAGCAGAGGCTTCTATTTCTATGCGAGAATTGCTCTGTTCTCCAACACTACGAGCCCCACTTTTGATCGGAGTTGTCATGCAGCTCTCCCAACAACTTAGCGGTATCAATGCGGTGTTCTACTACTCGACGTCTCTGTTCACCTCTTCGGGTTTGACGGAAGAATCAGCAAAGTTCGCAACGATGGGTATAGGAGCGGTCATGGTGGGGATGACATTGGTGTCCCTGCCCTTAATGGACAGAACTGGACGTCGCACGCTGCATCTCTACGGGCTCGGCGGAATGTTCATATTCTCCATTTTCATCACGATTTCCTTCTTGATAAAGGAAATGATCGACTGGATGAGTTACTTGTCGGTGGTGTCGACGCTCAGCTTCGTGGTTTTCTTCGCGGTGGGCCCCGGCTCCATACCCTGGCTCATCACGGCGGAGCTCTTCTCTCAAGGACCACGACCTAGTGCTATGGCTATTGCTGTCTTAGTTAACTGGATGGCCAATTTCGTCGTCGGAATCGGGTTCCCGAGCATGAAGGCGCTGTTGGAAAACTACACGTTCCTACCATTTAGTGCATTCCTCGCAATCTTTTGGATATTTACATACAAAAAAGTTCCTGAAACTAAGAACAAGACCTTCGAAGAGATATTGGCATTGTTCCGCAACACAAACGGCAGGGACAGTTTTCGCGATAGTCGTCTCTACGGGAGCATGATGAACTGCGTCAACGCTCTGGAACAACAGCTGCCTCCCCCACCCCCGCCCGCTCCCGTCGACGAAAAACACGACTCATGCATCCGGGCTGCATTGCAGTTAAAGTAG
Protein
MLGVLNRAKRYFRPGQRLALYKAQVRPRLEYCSYLWAGAPKYQLLPFDSIQKRAIRMVDSPALADRLEPLGLRRDFGSLCVLYRMVKRDMVAIKQELDTVQQVKEEIEELREYVDRLEEHTQRRKLRLLEQGLTFFLSYAILAAVLGMLQFGYNTGVINAPSKNIANFMKDVYKKRYGIDLHDGTVNSLFSIAVSIFAIGGMLGGFSGGMIANRFGRKGGLLLNNILGISGASLMGFTKISHCYELLIFGRFIIGVNCGLNTSLVPMYISEIAPLNLRGGLGTVNQLAVTVGLLISQVLGIEQILGTDEGWPILLGLAICPAILQLLLLPACPESPRYLLITRQWEEEARRALRRLRASNQVEEDIEEMRAEERAQQAEASISMRELLCSPTLRAPLLIGVVMQLSQQLSGINAVFYYSTSLFTSSGLTEESAKFATMGIGAVMVGMTLVSLPLMDRTGRRTLHLYGLGGMFIFSIFITISFLIKEMIDWMSYLSVVSTLSFVVFFAVGPGSIPWLITAELFSQGPRPSAMAIAVLVNWMANFVVGIGFPSMKALLENYTFLPFSAFLAIFWIFTYKKVPETKNKTFEEILALFRNTNGRDSFRDSRLYGSMMNCVNALEQQLPPPPPPAPVDEKHDSCIRAALQLK

Summary

Description
Facilitative glucose transporter.
Similarity
Belongs to the major facilitator superfamily. Sugar transporter (TC 2.A.1.1) family.
Belongs to the major facilitator superfamily. Sugar transporter (TC 2.A.1.1) family. Glucose transporter subfamily.
Keywords
Alternative splicing   Complete proteome   Glycoprotein   Membrane   Reference proteome   Signal   Sugar transport   Transmembrane   Transmembrane helix   Transport  
Feature
chain  Glucose transporter type 1
splice variant  In isoform T.
EMBL
NWSH01001179    PCG72228.1    AGBW02009564    OWR50443.1    ODYU01003758    SOQ42927.1    + More
KQ459593    KPI96736.1    JTDY01001975    KOB72419.1    BABH01036247    KQ434938    KZC12054.1    KQ414627    KOC67429.1    ADTU01021729    ADTU01021730    ADTU01021731    ADTU01021732    BABH01015756    KQ461108    KPJ09063.1    CH933809    EDW19603.2    JR035629    JR035630    AEY56555.1    AEY56556.1    KQ978169    KYM96596.1    CH954178    KQS43044.1    CM000159    KRK00711.1    CM002912    KMY96742.1    CH902618    EDV39546.2    AF064703    AE014296    AY059441    BT011383    AAC36683.2    AAL13347.1    OUUW01000009    SPP84932.1    KQ982766    KYQ50974.1    KQ976417    KYM89830.1    NEVH01006723    PNF37037.1    GL769399    EFZ10419.1    GL888384    EGI61918.1    KQ981953    KYN32497.1    GL452187    EFN77800.1    ADMH02001654    ETN61547.1    KZ288223    PBC32012.1    GGFL01004974    MBW69152.1    CH477280    EAT44948.1    KK853156    KDR10507.1    AAAB01008807    EAA04274.4    CH940647    KRF84716.1    KK107485    EZA50096.1    QOIP01000006    RLU21458.1    EAA45418.4    JRES01000997    KNC26281.1    CH916366    EDV97447.1    GL436428    EFN72020.1    PNF37047.1    CM000363    EDX08746.1    CH480817    EDW49982.1    PNF37040.1    AJWK01006616    GEDC01021510    JAS15788.1    GEDC01014486    JAS22812.1    DS235862    EEB19241.1    ACPB03000235    GEDC01012296    JAS25002.1    GEDC01029784    JAS07514.1    NNAY01002971    OXU20201.1    KZ150024    PZC74841.1    KQ435867    KOX70255.1    GGMR01019187    MBY31806.1    GDHC01007983    JAQ10646.1    ABLF02029341    ABLF02029346    GGMS01010501    MBY79704.1    PNF37042.1    UFQT01000606    SSX25663.1    CVRI01000035    CRK92725.1    SSX25662.1    KQ981124    KYN09323.1    SSX25660.1    SSX25659.1    LBMM01005725    KMQ91266.1    PNF37041.1    PNF37044.1    KB630363    KB631141    KB631630    ERL83558.1    ERL84132.1    ERL84865.1    ALI30448.1    AHN57921.1    PNF37052.1    AHN57920.1    GFDL01003014    JAV32031.1    PNF37050.1    GGFM01004405    MBW25156.1    GECU01012117    JAS95589.1   
Pfam
PF00083   Sugar_tr        + More
PF00450   Peptidase_S10
Interpro
IPR003663   Sugar/inositol_transpt        + More
IPR005828   MFS_sugar_transport-like       
IPR036259   MFS_trans_sf       
IPR005829   Sugar_transporter_CS       
IPR020846   MFS_dom       
IPR001563   Peptidase_S10       
IPR018202   Ser_caboxypep_ser_AS       
IPR033124   Ser_caboxypep_his_AS       
IPR029058   AB_hydrolase       
SUPFAM
SSF103473   SSF103473        + More
SSF53474   SSF53474       
Gene 3D
PDB
5EQI     E-value=1.3278e-107,     Score=998

Ontologies

Topology

Subcellular location
Membrane  
Length:
647
Number of predicted TMHs:
12
Exp number of AAs in TMHs:
246.76832
Exp number, first 60 AAs:
0.00096
Total prob of N-in:
0.99163
inside
1  -  131
TMhelix
132  -  154
outside
155  -  189
TMhelix
190  -  212
inside
213  -  218
TMhelix
219  -  238
outside
239  -  247
TMhelix
248  -  270
inside
271  -  278
TMhelix
279  -  301
outside
302  -  310
TMhelix
311  -  333
inside
334  -  395
TMhelix
396  -  418
outside
419  -  432
TMhelix
433  -  455
inside
456  -  461
TMhelix
462  -  484
outside
485  -  493
TMhelix
494  -  516
inside
517  -  528
TMhelix
529  -  549
outside
550  -  558
TMhelix
559  -  576
inside
577  -  647
 
 

Population Genetic Test Statistics

Pi
17.236839
Theta
18.001669
Tajima's D
-1.398841
CLR
0.031667
CSRT
0.071896405179741
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号