SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00058
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.404 Nuclear   Reliability : 1.972
 

Sequence

CDS
ATGGACGCTGTATTCGCGGAATTCCTCCGACTTCGCCACCCACAGCTCGCCTCGGAGTTTTTGGCCTTCAAGGCCAATCACACTGCGAGCCCTCTCGAGGACTCCGCCGCGCTCGCTGCTCCTGCGTCGCCTGTACCTGCGTGCAGAGCTTCTGCATTGAGCACCGCAGCCTCTGTCGTGCCTGCCGCTCCCGTGTCGCCTATACTGGCGAGAAAAGCTGCTGCGTCGTCCGCCGTGACCATCGTTTCAGCTGAGCGATCATCCGCGGCCTCCGTCGCGCCCTCTAAAACACCTACACTTGCTCGTAGGTCGCCTGCACCCGCCTCCTCGTGCTCCGACTCTGACTCGGACATGGAGGTCGACCTCGCCCCCGCCTCATCGACGGATGGATTCACCCTGGTACAGAAGGGTAAGAAGCGTGCCGCGGAGTCTCGAGCTCCCGCGGCCGCTAAAATTAGCAAAGCCGTGAACGCGTCGCGCCCCCGCCCTCAGACTCCCGTTGCGCCCCCAGCCCGTGCCACTCCGTCGCCGCGTCCGGTGGCACAAAATAAAACCCAGACCCCTCCCCCGGTTATCCTTCAGGAGAAGGCAGCTTGGGATCGAGTTTGCCTGGCCCTTAAGGCCAAAAATATAAATTTCACGAATGCCCGTAACCTCGCGAACGGCATTCAAATTAAGGTTCAAACACCCGACGACCATAGGGCCCTCTCTTCTTACCTCCGTAAGGAGCGTATAAGTTTCCATACGTATACGCTCCAGGAGGAGCGCGAACTCCGCGTTGTAATACGCGGAATCCCTAAAGAGTTAGATGTAGAGCTCGTAAAAGCCGACCTGTTAGAACAAGGCCTACCAGTGAATTCTGTGCACCGTATGCACACCGGTCGCGGTAGGGAGCCATATAATATGGTTCTAGTCGCTCTCCAGCCTACCCCGAGGGAGACCCTACTTAAGCCCGCGCGCCGTGACCCTAAAATCGCGAACTATAACATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGCCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGTTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCGACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTATCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGAGCCAGTCACCGTCGACGCCCTAG
Protein
MDAVFAEFLRLRHPQLASEFLAFKANHTASPLEDSAALAAPASPVPACRASALSTAASVVPAAPVSPILARKAAASSAVTIVSAERSSAASVAPSKTPTLARRSPAPASSCSDSDSDMEVDLAPASSTDGFTLVQKGKKRAAESRAPAAAKISKAVNASRPRPQTPVAPPARATPSPRPVAQNKTQTPPPVILQEKAAWDRVCLALKAKNINFTNARNLANGIQIKVQTPDDHRALSSYLRKERISFHTYTLQEERELRVVIRGIPKELDVELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQPTPRETLLKPARRDPKIANYNMVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLAISLAESDPPSLPFNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSRRPLTAGVPQGSILSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRSQSPSTP

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB055391    BAB21761.1    AB018558    BAA76304.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    KQ971729    KYB24751.1    ABLF02042518    ABLF02057746    GALX01005359    JAB63107.1    GBBI01004395    JAC14317.1    GGMR01018716    MBY31335.1    NEVH01021205    PNF19912.1    ABLF02008153    ABLF02008462    ABLF02008464    KK119261    KFM75202.1    NEVH01009134    PNF33528.1    NEVH01011985    PNF31054.1    NEVH01027074    PNF13841.1    GBBI01004571    JAC14141.1    NEVH01017470    PNF24199.1    GGMS01006359    MBY75562.1    GFTR01008279    JAW08147.1    ABLF02034467    NEVH01006736    PNF36716.1    ABLF02023911    ABLF02024246    GFTR01008262    JAW08164.1    GFTR01008261    JAW08165.1    GGMS01002992    MBY72195.1    NEVH01005277    PNF39135.1    GGFL01004957    MBW69135.1    GFTR01008256    JAW08170.1    GFTR01008271    JAW08155.1    GGFJ01001857    MBW50998.1    GGFJ01001858    MBW50999.1    GGFL01005012    MBW69190.1    GFTR01008257    JAW08169.1    S59870    AAB26437.2    RPOV01000134    RPJ78669.1    ABLF02040174    ABLF02040183    ABLF02055266    GFTR01008151    JAW08275.1    GFTR01008260    JAW08166.1    GGMR01003864    MBY16483.1    GGMR01000676    MBY13295.1    GFTR01008251    JAW08175.1    GECL01003538    JAP02586.1    KK119692    KFM76444.1    GGFJ01001844    MBW50985.1    GGFJ01001842    MBW50983.1    GGFJ01001843    MBW50984.1    GGFJ01001822    MBW50963.1    GFTR01008246    JAW08180.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    NEVH01016302    PNF25823.1    GBBI01003810    JAC14902.1    GGMR01000226    MBY12845.1    GBGD01000415    JAC88474.1    AY060438    AAL25477.1    GFXV01000908    MBW12713.1    AF456125    AAL57609.1    GEZM01084969    JAV60363.1    AY180919    AAN87272.1    NEVH01026386    PNF14434.1    GFDL01000006    JAV35039.1    GBGD01000389    JAC88500.1    GGMR01012676    MBY25295.1    GFTR01008269    JAW08157.1    NEVH01020940    PNF20481.1    GFTR01008169    JAW08257.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.0905943,     Score=88

Ontologies

Topology

Length:
1106
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.81062000000001
Exp number, first 60 AAs:
0.00071
Total prob of N-in:
0.00013
outside
1  -  1106
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
2.125048
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号