Gene
KWMTBOMO00055 Validated by peptides from experiments
Pre Gene Modal
BGIBMGA002034
Annotation
PREDICTED:_uncharacterized_protein_LOC105841266_[Bombyx_mori]
Full name
Titin homolog
+ More
Muscle M-line assembly protein unc-89
Titin
Hemicentin-2
Obscurin
Myosin light chain kinase, smooth muscle
Hemicentin-1
Striated muscle preferentially expressed protein kinase
Striated muscle-specific serine/threonine-protein kinase
Roundabout homolog 3
Palladin
Contactin-2
Peroxidasin homolog
Roundabout homolog 2
Obscurin-like protein 1
Muscle M-line assembly protein unc-89
Titin
Hemicentin-2
Obscurin
Myosin light chain kinase, smooth muscle
Hemicentin-1
Striated muscle preferentially expressed protein kinase
Striated muscle-specific serine/threonine-protein kinase
Roundabout homolog 3
Palladin
Contactin-2
Peroxidasin homolog
Roundabout homolog 2
Obscurin-like protein 1
Alternative Name
Obscurin
Uncoordinated protein 89
D-Titin
Kettin
Connectin
Rhabdomyosarcoma antigen MU-RMS-40.14
Muscle M-line assembly protein Unc-89
Kinase-related protein
Telokin
Fibulin-6
Aortic preferentially expressed protein 1
Roundabout-like protein 3
Axonal glycoprotein TAG-1
Axonin-1
Transient axonal glycoprotein 1
Obscurin-RhoGEF
Obscurin-myosin light chain kinase
Uncoordinated protein 89
D-Titin
Kettin
Connectin
Rhabdomyosarcoma antigen MU-RMS-40.14
Muscle M-line assembly protein Unc-89
Kinase-related protein
Telokin
Fibulin-6
Aortic preferentially expressed protein 1
Roundabout-like protein 3
Axonal glycoprotein TAG-1
Axonin-1
Transient axonal glycoprotein 1
Obscurin-RhoGEF
Obscurin-myosin light chain kinase
Location in the cell
Nuclear Reliability : 2.728
Sequence
CDS
ATGTGGGAAAATGAAACAAAGCCGCTGGACGTAGCTTCTTGGGAGCCTCAAAAAAGTCTACTGATAAAGTCTCAGAGTCGAGCGGGAGCGTCTTTGGACGACCGGTTCGTGTCCACCGAAGAGGCCGGCGGCGTCAGGCTGACTGTGTCCACTGCCCGGACCGGCGATACAGGCGTCTACACTCTACAGGCCAGCAATGCGGCCGGTAGCGATACAGCGAGAGTTCGACTGGAGGTATCAGCGGAGGAAAGCCCCTCCGGTGAGGATCCGCCCACCTTCCTGCGGCGACTGCAGGATCTCACCGTCAAGGTCGGAACCAGAACGCGCTTCCTCGTAGAGATCATCAGCTCTACTGAGTGCAAGGTAACATGGTACCGGAACGAGCGCCGTTTGCTCGAAGCGGAGCGCGTGTCGATCGTGAGGGACGGGAGCTTCTTCTGCGCGGACGTGGCGGCCGTGAGCGTGGACGACGCGGGCAGGTGGACCTGTACCGCCGAGAACGTCGGGGGCCGGGCTAGCTGCTCCGCGCACCTTAATGTATTAGTCCCGAAAGCCTACAAACGTCCTGAGTTTGTGGAGGAGCTCCGCGCTTTGTTGACCGAGCAAGGCACCGTCTCCCTCGAGTGTAAAGTGGTCGGGGTCCCCACTCCCGTCCTCAGGTGGTTCAAGGACAGTCGTGAAATAAAAGCCGGAGACGTGTTCGCTTTGACGGCAAACGCTGAGGATCCGACTTCCCTCGGCACGTACACCTGTGAAGCTGTCAACTGCATGGGCAGGGCTTACTCTTCTTCCAAGGTGCACGTCGTGGGACGCGCGAGCAGGGAAGGATCCCTTAAGCCAAATTCAAGCGGACTGTCGCCCGAGCCGCCCCCGATATTCACGAGAGAACTGGAAGACCAGTACGTACGAATCTGCGAGCCGTTTACCTTGAGCTGTCAGATCGTGGTCCCGCCTTGGCCGCGGTCTGTAGTGTGGTACAACAAGGAAGGGAAGGTGGAAGCTGGAGAAAGGTACCACGTTTTGGAAGATGGCGTCGGTGGATATGTGCTGGAAGTCAGAAGCGCTGAGTGGCGTGATGAAGGAGAGTGGAAGTGTGTGGCGACCAGCAGTGGGGGACGCGTTGGCATCTCCACTTGCAGCCTTAATATGGACGTGCCGAAAAACTACAGGAAACCCCGTTTCATGGAAAACCTTCAAGCGGTTCTCACCGAAGAAGGACTGGTATCGTTCGAATGTAAAGTCGTCGGCTTCCCCACACCGGTGCTTAGTTGGTTCAAAGACGGCCAAGAACTAAAACCTGGTGACGTATACCAATTGACCGGAACTAACTCTCTGGGATCGTACTGCTGTATAGCGAAGAATTGCATGGGTCAAGCCAGCAGCTCAGCTGAACTAACCGTCGAAGACATACAGAACCAACTTAACGAGGAAGAGAAGTTACAGCTTTTCTCTAAGAATCAAGCGCCTAAGTTTGTGCACGGCTTGAAGAGTGTAGAAGCAAAAATAGATGAACCATTCCGCTTCACTATAAAAGTTGCAATTCCGCCTGAACCTTCTCTATTGTGGTACCGTGACGACCAGCCAGTGGACGAGTCTTCACGCTGCCACCTCGGCAAAGAAGAGCGCGGCGTCTTCTTCCTTGACATCCAAGCTCTTGAGTTCCTTGACCAGGCTGAGTGGAAGTGCGTCGCTTTCAACGATTTCGGACAAAGCGTCACCTCGTGCTTTCTCAAACTTATAATACCGAGACATTATAAAAAACCTAGGTTTCTAGAAAATTTGCAAGCCATTTTATCTGATGAAGGCGCTGTAAATCTCGAGTGTAAAGTAATTGGTGTTCCACAACCAGTTCTTAAGTGGTACAAGGACGGCGAAGAATTAAAACCTGGTGACATACACAGAATTATATCAGGACAGGATGGTACCTGTAGCCTTGGAACCTATACTTGTGAAGCCTCTAATTGCATGGGAGTAGCCGCCAGTTCTGCCTCATTGCTCGGATTCGAGGAGTCTATGAAGGCTAAAGAAAAGAAGAAAGCCGAAGAACAGGCTCTGCAAAGAAACTTATCTTTGAGCACTATACACGAAGAACGAACATCGCAAATGTATGATACTCCAGTTGGAGACATTACTCTCGATGACAAAGGAGAAGTATCTTTCTCGTTTGATGGAAAAGAAGTGTCGGTTTCCTTATACGAAACACCGGATCTGACCGAAGAAGAAGCATTACAAATAGTGGAAATGTACGCCGATCAGTTATCAGAAAACGTAACTGAGCATAACGTTGTTGAATTACCACCTCTGCGATTTGTCAAAGAAACTTCTACATCGGGAAATTTATTAATGGAAGCCCTAGTCATTGATGTTTCTCCTGAATATTTTGCATCTCCAGAAGAAGATCTAAGAACTGAAGCTGACGTTGAAGATATTTCCATCGCAGATGAAAACGGTCTTCCGCAGTTATCATTGGACCAAGAAATTGACATAGCAGGTGAAGACTATTTAGAAAAGACAATGGCTCTTTTGTCTGAAGAAAAAGTAGACATCCCATTAACATTAGGCAGAAAGAAATCAGATTCTCAAAAAAGTGGAGAGGATTATTTTAGTTTGTCTAGAGAGCAATCATTGTCTGAAGAAAAGAAAGATGACGACACGCAGGTGATGTCGGAAAGTGAATTACAAAGTTTTGCCAGTGCTCACAGTTCCGGAAAACCCAAATCCAAATCTTCTAAGCCTAGTGGAGAAGACGGCCATGAATCCTCTGATCTAACTAAGACAATTCTTTTGAGAGATGACATGCAAAAACCAACTGAGAGTGATGTCAAAACTTCTGCAAGGAAAACAAAACGCGAAAGAAGGAGTAGCCGCGGATCTAGCGGTAGTGAGAAATCTGTTGATAAATTTAAAGATGAGTTAATTAAAGAGCAAACGATCATTGCAACTGAAACTGAAATGGAGGGAAAACAAGTAATGACGAATGAAGAGTTTAGAGTATCCATGACAAACGTTAGTACATCCCTCAATAAAGTGATCAATGATATTGAAAAAATTGAAAAAGAAATCATCATCAAGTCAGAGCTTATGGCTTCTGCTGCTACCGCTTCAAAGAGCTTGGAAATAATAAGTAGCTTAATAAATCCACTTTCTGAAATTCTTAGTATAACTGACACCATTCAAGAATCTGCTTCAGAAACCATTGAAGTACAGCGTACTCTGTTCTCTAGGCTCCCTAAGCCATTGAAAGTATTGCAACAAACTCTTACGATCATAGAAAAGTGTATAGATGTTGAAAGTGACAATCGAACACTAGTCAAGAAAACTTGCGTTTCCATCATGGAAAAATGTGGTAATGCAATTCAGAACCTTGTTTCCGAAATAAATGCCATTGAAAAGAAAGAATATTTATTACTAAGTGAAAATGTGTGTAATGAACTTGACGTAGTATCAAATGAAATATCTACGGTTGTAAATTTTTCTACAGAATCGATTAAGACTAATAATCTGCTAAACGAAACAACTGAGGTAAAACTTGAATCGACAGTAGAATCTAAGCATTTAACAGACACTCAAAAAGCTCTTTTTGAACTCAAAGGTCCATTAAGGTCTTTGCTGTATATTGTTGACAGTGCTGAAAGTGGAAAGATCGTAGATATTTCCCAAGTTAATAACAGCGAAGTCATTTTAAACGACATGTCAGCATCGATACAGGATCTCCAAAGTGCATTGGAGCAAATAGAATCACTTTCTGTACTAGAATGTGCAACATCTTTGAATAAATATAACACCGAAATAATTGAAAATGTTATGGAACCTGTTCTTCAACTTCGAAGCTCATTCGAAAAAATGTCAACAGAAATAAAAGCTGAAGACAAAATTCAGTTGAATAAAGTTTTGTCATCAATTAAAGAAAACTTAACCGTTATTTCATCATACATTAATAAAGTGGAAAATAATATAGGTGCTTTTGATGTATTGCAAAATGAGAATAAATTGGAAGCACTTCAAAAAATGGCAGAGACACTTATTTCGTTGGAGAAAAATCTACCTACACTGGACACCATGCCACAAGTCCAAGGCAACATGAATTCTTTTCACAAAAATCTTACCAAAGCCTTGGAGAAGGTGATCGAAAGTAATAATGCTAACAAGTACTTATCGATGATCGAGATTTGCGATGGTATAAGACGCATTAATTCTTGTATAAGAGATATGGACACGGACAATATTCTAAGCCTTGCAAGCTTAAGCAACACTCTTAAAATTATACAAAATCAATTTATCAAAAACATATTTGATTCAGAATTAAATTGTTGTGTAGTAACAAATATAACTGATATACTTATTGGAATACAGGAGACAATTAATCAAGCTCAGGAATTTACAACAGAAATACAATATGATAATTTTCAAGATACACAAGCTCCAATATTTGACTCGACAAAAGTTGAAATAATAGTTGAACATGTAAATCAAACGGTCGCAGCTATTAATCAAGTGAAATTATTAGAAACTACGTCATCTCTAAAGGAGAACATTACACCAACTCTACAAAAAATTTGTCCAATATTAGAAGAATTGAAACAAAACATTGCATCAGCATGCGTTGGCGGAATTCAGAAAGAAGCTTACGTCTCGGATATCTCAGAAAAGTCATTTTCTGAAAAGTTTGCGGTTCCTCTCTCTGAGCTGAACCACAATGTTATAGTTCTTAATCAGACTATAATCGAAAATATTGAAAGCTTGAAAGAATCAAACGAAATTGTAACTGCTATAGCGGAACCATTACAAGAATTATTTAGAACTTTAGAGGTTATACAGCAAGACGTAATTTCTCAGTTTGGTCCTGATCTGAGTCCATATGAAATTAGTGTGGATATAGCAAGCATTATTCAAAGCTTACAGAGCTGTGTTGTGATGATTCAAGATCATGCTGCAATAGAAGTAGTTGATGATATGTCAACATTAGAAGATATTTCTGGAATTAAAACTACTGCTGAGACAGCTTCGGCCGACCAATTGGTACTTCCCACTGCTGAATTTGCTACAACAGAACAAACTCTAGGATCATTTTATGACGAACAACCAAAATCATCCATAGCTCAAGCTTTGCATGTTTTGAATGAACATTTGACAATTTTACAAAGTCCAGAAATCATTGATGCTATCGACACGCTTTCTGAAATAAGCGACTATTCCAGTCTCAAATCTGTAACTCTGGGTCTGAGTGATCTTCATTCTGGAATAGAAGAAGTTTTGCAACCAATTGTGTTAGAAGGTTTGCAATCAATTAATGCTTCTAAATTAGCAGCTATGGCAGAACCTATGCAAGTTCTTCAACATAGTTTATCCGTAGTGGACCCAAACAACATTCCAATTTATGAAAATATATTAGAGTTACTTACGGATAATATACATTCCGTTTTAAACAAAATTAACGCTTTTAAAGAGCATTTAGATAAATGCATGCAGGCTATTTTGCCAGCTTTGGAATTTACTAAACAGTCCATTGAAATTTCGAGCTCAGTAAATAAGTTAAGAGAAGCGTGTCAACATTTAAAAATAATGCTCAAGTCAATTAATCAAAGCTCTACAACTCAAATTCCCGAGGTTCAAGTGTTAGACGATGTAGTCAACGAGATCTTAATTGCTACCGATGTAACAGAAGGCATAAAAATTGAACAAGTGAGATATTTAAGCGAAGAATTATACGCCAGAGTGGCTGGTGTTCGGGAAGAAATTTTGAGGTTTACGCCGAACTCTTCAGAAGCTTTACCTAATGAGGCATCTTTCATACACACTATTGAGGAAGTCGAACATAATATTGCTGTATTGGAAGAATACGATTTTGTGGATTTATCACGAGCTTCTGAATTGTCATCATGTGCTTCACCGCAAATAGCAAAAGAAGTTGAAATAGAATCTCTTGTGCACATTAGTGAAATTGTTGAAACTGCGGTACGTATAATAAAAGACGCTGGCGAAGATACCCCTATGGCGGACTTGATGATTGTTGAAGATTTTTTTACGACTTGTAAGAACGAATTTACCATATTACGCTGTCTCTTGAATAAAAGCATGAGCCCCAAAAAAATTATTAGATTAGTGCAAGAGTTTTGTAACATTCAAAGTACTATTCAAGGTTTTAAGACTAAAACAAATGAACTGCAGCTGTCTGATGATGTAAACCAATGCATCGAGAGTTTTTTGATTCATAGCGATGATTGTTTAGCAACTGTACGACAGTCTTTAATAAAAATTGTAGAATCACAGTCTGAGCTCTTGTTTAAATCTCCAATTGTTAATCTAAAGTATTTAAGTCACCGAAATCACTTTGATAAAATGGCTAATCTTGTTGCAAAGTTAGACGATTTTGTTGATGCAGTCAAACCCAACGCCGAAAATATCAAAGATAAAATCATAATGGAATTAAAGAATCTTGATTTATGCAATGTCAATAATGAAGAAAATAAATTGGTGAGAACAATGGACGATTTCTTTAGATTTGTAGAAGACGAAATAGTGGTACAAGAAGATAATGACAAGAAAGTTATTTTGAAGAAAATTTTAACGTGCCTTGAAAAACACCAAGATTATAAAGATGCTACTGATGCTGGCAAAGTATTAATAATAATGCATTGCCTGTCTAATTGTGTGGATATATTACAAGAGAGCTTAGGAGAAACTAAGCAAAAAATTGAATGTGATACAAATGATGAAGCATTGGATATTAAAGCTGCATTAATGGAAATGGTAGAACCGCTGCAGAATCTTCATACACAACTAATTCACGTTCAAGAAGTAGTTTTATCAGGTGTGCAAGAAGATTCAATTTCACTTGATATTGACTCTGCAGAATCTATAGTTCAAACTATATCTGATGTTCACAAAAAAATATCAGCAAAACTAGAACTCGAAACTGTTAATGTTTCTGATAAGGATGTTGCTTTAATTTTTGAGGTGGATAAGGATTTACATGCCATACAAGATAGTATTAAGGCGTTAAAAAATCAACCTGCAGCCCAGGACATTAAAGACGTAACAAAGCAAATACAAGATGTAGAAAAATCTTTACATGTTTTAGTTGCATCAGAAAATGTAATTACAGATGTGAAAGATAAAATACCTAAAGGAAGTACAGAACAACTCGTTCAACATATCAATCAATATATAGAGTTAATTGAAATAGTCGAAGAAATTTCTGCTGTTATTGAAATTGAAGACTTGAAGGAGACGATCGAAATGGCAAAAGATCTACGTGAGACTTTTGTGACCTCAGATATGATCAACGACGAAGTTGCTGAATCTATAAAGGAAGAAATTTTGATCGAACAAGCACGGCTAGCACATAAACTGCAAAAGGCTATATCAGCTTTACAAGTACAAGTATTTGATAGTGCCCAAGAAATGGTACCAGAATTAAGCACAGAAATCTTTCAAAGAGTAGCAAGAGTAACAGCCCAGCTACAAGCAGACTTAATGGCTGTGACTGGCGTACATATTACTATACAAGCTCCGCCCTATGTGCTCGATGAAGTTGCTAAATCGTTGGAAACCATAAGCACAGAGAATAGACTAGTACCTGAGTCAGCTCAAGGCGATAAATTGGTTTCTATTGTTGAAAACGTGAATATGTTTGAAAATACGGCAGACCCACCAATCCAACCCAAACCAAAAGAATTAAGTAATATAACTGTTGAACCTGAAGAAGTTAACATAACACAATTATTAGAAGATGTATCTTCTAATGAGCGTGTTATAAATGAAAATTTAGTAACTGTCACCCAAGAAGTGGCAGTAGCACAGATGGAAACAAATATGGATATCGCTGGAGTAACTAAAAAAACCCAGGATGGTCTTATAAAAGATGATATAAAATCATTTAGCATATCAGAAGAAGCCCAATCAATTTTTGAACAAGGGTCTCCTGAAGTTTATAACGTGTTAAATGCAGAGGAGTTAGCATCTAACCAAACATTCTCAGCAGACTCAGCGTCAAATAATATGCCTGATAATGAGTTGGATATTGTGGAACCAGTTCTAGTTTGTTCTGTGCCTGCTAGTTCTTTGGATGATTTAGAAGGATCTGTAAATCCTAAGACTGGTTTAGTAACTGATGAAAAAATAGACTTACAGAAAGTTGATGTCACTATAGAAATGCCGGAGATCGCTCAATTAGATAAATGTCAACCGTTCTATGCTAAGCTAGTAGAGCATTTGGACGAATACGTTAATGAAAATATTATCGAAATAGTTGATGAATTTTCTTGTTCAGCTAATTTACATGAACTGATGCAATCTGTAGATTTAGCTAAACAGCTACAAAAAAGTATAACAATATCAGAGTCGGTAATCGAGCCTAACATTGAAACAGAGCCAAACCCACAAAGCCCAGTATATTTGGCATCACAACTAAAAATGGCCCTTTTAGTTCTTTACAATCAAGAACTTGAGAGTTTAGAAGTAATGGCTCCTCACCTAACCAAAGATAAATTGAAGGTTATATCTGAAATAGTTCACAATTTGTGTGATGATTTAACACAAGTGATGGAAGCTGTACAATCTAATCAAAACACATCTGAAAGTTCTGTTAAAGAGTCTGTACAAAAAGCTAATGTTGTAGAGCAAGACTTAAATTCACCTGAAGAAATTGATGAGATCTTCGAAACTAAAACACCATTACAAGAAGTTGGAACAGCACAAAACATTGTTTCGTTAGAAGAAACCTCTACAGATTTATTATCAGAAGAAAAACACGAAACAATCGACACTGCAGAAATAAAGTCTGTAGTAGGAAAAATTACAGACAATTTGTTTTCAATCGAAGCAGCTCAGTCTATTGAGGTAAAAGAAGATTTTAGTGATGTCAAATCAACAGATCTACGAGTAACAGATAGTGTAACTGAAGTATTGGAGTCATCTGATGTTAGAGTAATAGAAAATGTATCTAGTAATACCAGCTGTGACACTATTGATCTTCCCTTAAATGAAGACAATTATTCAATTCAAACGGCACATAGCACAGAAGTTGAGCCTGAACGTCTAGACAGTAGTGTTATTTTAGGTGGCATATCGCTAAAGCAGGTACCTGATGTTATGAATTTGGAAATGGAAGAAGAAGAAGCATTTGAAACATTAGCGGGAACTACACATGAGACTACAGAAAATTTGATGGGAGAAAATGTTTGCCCTATTAAGAATGATGAAGTGAATATCGAAATAATTGATACTTTAATCTCAAAAGAGGACAACGCCGATATTGAACAACTTAAAAAAAATCAGCCAACATCTTTAGAGTCAGATGACGTGCCAACGAATATAAACTTATTAGTAGATGATTCGTTGTTGGAAATAGATAAAGCTGTAAAAAGCACTGAAGCGCTAAAAAATATTCCTCAGAGAGACCTAGCTGAAAATGAACAACAACTAGGGGAAGATACAACTGGATCGAAACAAAAAGTTGTAGAATTACCAGATACTATCGATGACGTGAGCCAAGACATGATTGTGGAACATTTGCCAACCAGTGAAGTAAAATTGTTAGAAGGACAACTATTAGCTGCTGAAGAAAATACGTTATCAGAAGCTTTGAAATCATCATTAGTCACAGTCCAAAAAACCACAGAAACGCCATTGGATGACACATCCGTTGACCTCGTCAAAATCGCTGGCGAACCTGAAATAAAATCAAAGCTTGTAGAAGAATTACAAACTATTGCCGATAGTAAAAGCCAAAAGATGATTGAAGAGAGCACCACGAGAGAAACAGTTGAGTCACCTTTAATTACTACCGGTAAAACTACTGAAACGCCAAATGACATAACTTCTATGAACGTCGGAGAAACTGAAAAACAAAGAAAAGAATCTATAACTGAATTAAATCAAAAGTCATCAGACTTTACAAAATCACAAAGCATTGTCAGTGACGTAAGCCAAGAAATACTGGTAGAACATTTAATAAGCGATGAAATCAAATTTACAAAAGAGCAACAATTGGCTAAAGAAGATTTAACAGCAGAAGTCAATTTACCACTTGTGACAGGTCATGAAACTATACAAACACTAAATTCCAACCTCGAAAATGAGATGTGCGAATCTTTAAAAATAGAACAAGCAGTATCCGCAGAAACTACGGAGTCAACTGTAGAATCACAAAGAGTAGCCAGTGAAGTAATTCTAGAACTAGTATCGGAACAATTAAAAAAAGATCAAGCTGAAAGTTCTAATTCTCAAACTGCTGAAAACATAGTTCGAGAAATTGTTGTGACATCGGAAATCACAGCATTAGAAACCTTAGGACTACCGTTAGAACGTTCCGGCAATGATGGTGATCTAGTAGAACTTTTATCCATTGAAACGAAGCAAATAACAGTAGAACCGCGAGCAACTACTTATGAAGTAGTTGCTGAACAGCAAGTAGTACCTTCTGGGCAGCAACCAGTTGAAGCTATAGACTCTATGAAAAAGGAACCTCTGGATGCTATGGAAATCCTACTAACTGGAGCTGCCACTTCATTACTAGTTACAAAAAATGAAATCAAAGAAGCAAAGAGTGACAATACTGCCGAAATCACAAAAGTTGAAGACGAAATTGCAGCTGAAGCAGAAAAAGAAATGGTACCAAAGGTTATATGTGAAACAACTCAAGATATGGCAAGGGAACAAATAGAGGTTGAAGAAGTTGTGGATGTAAAGTTACTACCCTCAACTATTGATCAAATAACATACGACAATGTCGTTGAGTCATTGATATGTACACCATTGAAAACTATATCTAACACATTAGCTGAAAATATTACTAGTGACGTAAATAGCACTGTTACAAACCAAGAAAAACTATTAAAAACTGAACAAGTGACAGTTGAGATGCAACTAACCGAAAATGTAAAATGTGAGGAATTATGCTCAAAACAATTAAATAATGACCAACTAGAGCATTTAAGTACACAACCTTTAGTTGTTGAAAATATTCCGCAAACGATAGCTGTTGAATCATTGACAGTCGCAACTATTGATTGTACAGAAAACTTGGCAAGGGACGTTAATGACGTCGAAGACTTCGAAGCAGCATCTTCGATTGAATTGAATCAAGAAACCATGCAATCACAAGGCATTGTGTGTGAAATAATCGAAGAAAACCTTGATAAACAGATAAAAAGTGGTGAAGACAGTTCTTTAGAGACGTTCAAATATTTTCAGAGTACTGATGCTCCTGTTAGAGAAGCAGTTGAATCAACAGTCGTTTCGGCTATAGAAACGACTTGTGAGTTAGACGAAAACGTTCAGAACGACATTGTTGAAACTGTTAATATAGAAGAAGAATCTTCAACTAAAGCAAGACGAGTAATCATGGAATCACAAGGTGTAGTATCTGAAATCAGTGACGAACTTTGTACGGAACAGTTAGCTATTGATGAAACTCCTGAGTCGTCACTTAAAACAGTACTTGAATCTTACGAAATATTGAAGGATGGGAATAGCAGCGACGTTGTAGAAGACAAGTGCCAAACTGTAATCTGTGAAATAACAGAAGAGACGGTTGTCGAACAACTTAACGAATATCAAGCTCCCGACTTAGAACTAAAATCTGCAGCTGCTGAAAATGTACCAACAGAAGCAATTAATTCACTTGTAGTCACAGTATTAGAAACCACAGAAATATTCACTGGAGATATTAGCAATGATGCCTCTGATTCCTTAACAATTCAAAATATTCCTTCAATGTCAAATCTCCAAATCGAGAGTGCCTTTGAAACTGATTTAAAGCAAAACCAAGTTAATGAAAATTTTGCCGCAGAAAATGTTGTTTCGTCAGAACAACAAGCCCCAATCACGGCTGTAGAAGAAACTTTAAACACTACTGACAATGTAATGTCAAATATTCCTACTGATGATGCTCCAAAACCAAGTGCGCTTATTGCGTGTGAAGAACAATACTATGTTCAAATAACCGAACCTGTAGTAATAGACAAAACGGAACCTATTGAGGAGTTTGGGAGTAGAATAGAAGCGATTTCTCCTGAAGACACCGGGAATGAAGTTATTTTAAGGGAATCGTTCGACAATGCAGAGGTTGTGGAAATTGTCTCAGTCGAAGCCGTATCTGAAAATGCAATGGTACCGTATTTCGAATTGGAGAGTGCAGATATGTTATCAAGCCCAGATGTTTTGGACAGCGTCGAAGATAAGCTTGCGAGTGCCTCAGAAATAAATGAAACACTAAAACACCACATCAATCGATACCTGAGTGATAGCATAGTAAAAGCAACACAGGAATTATTTTCAGTTTTCAATGTAAACAAATTAAACCAATCAATAAATATGGCAAAATGCTATTCTGAGTCTGTAGTTGTAGGTGGGAATTCTGTTTTACCTACAAGTAAATATTCTGTAAATTTACTGCATCATTTAGACTCTGCCATGAGAGAATCTCTGCATGAAATTCTTGAAAATAAAGATAAAATCCCATTGGCCGAGAATGAAATTTTAACTAATATAACCGACATACAAAATCTTATTATTCAAGATATATCATTGTTGATACCTGCATTAAGTATGGCACGTGTAGCCCACCATGATTTAGATATAGGACAGTCTACTCATTCAGATGAAGAATTAAATCTGAAAGTAGACTCCAGGAAGGAAGTTGAGTACGAAAACCCTTCGTTCTTAGGATTAGCTGTTCAAGACTTCAAAACGACTCTCTCAAGTAATCTTGGGGAAAACAATACTACAGTCAATTCATTAGAAAACGATGCATACGTGAAGGTTTTGGCCAAAAATATTCAGGTAGAAAATGTTGTGGAAAAAGAAACCAAGATAGAAGGTAAAAATGATTCTCAAAATGTATCGGAAGTAGAGATTAGTAAATTTGTGGAAGCTTACGAAGGAGAAGTCATAAGATGTAATGAAAAAGAAAACGAAATAGAAGATCATTTTCAGTCGAGTTCCACAGAAAAAATAAAATCTACACAAGAAAATTCTGTCATAAATCTAGAACAAACACCGGTACAAGTTTTGGAAATAAATACTACAAATGGTGTAGAAGGTGAAATTAATCACGAAACAAATTTATCAGGAACATGTCTTGACACTTCAGAAAATGGAATTGACCTTATTCAAAGAAATTTATTTTCGGAAAAGGTCATAGAAGACTTTGAAAAGTCGTCACCCGAACGAGATAAATTTAATAGTGAAATGTTAAATACCCGTGTTATAGAAGTGATAGCGTTGGAAGAACTCGAATTATGCTATGAAATTAATAATTTGAAAACTAAATATCCTGAATATTCTGAAGAAACATCTACACTAAAAGAAGTAAATACCAACCCTAGGGAAATGAATCATTCCGATGAACATAATGTAGCTCCAGACTGTAAATCATCCACTAAAAAAGATCAATTTCCCAACTTAATAGAAGCAAAAATAGAAACAGTACCAGTGCCAGTTCTGAAACATTTTTTAACATCACATTTGACAGTCTTTCACGAGCTTGCGAACCTAGATAGTGATTTAGAGCAAAAAAATTCTGAAAAAATAGCTATGATAAATGAACCGCAATTTGTAATTTTTCAGAATGCTATTATTAACGATAATATTATGAAAAAATCAAATGCAACGGAAAAACTTGTAGATCAATTGAGTGAAAAAGTGCAATGTCGAAATGTTGTTGTAAATGAAAATGAAATTGTAATTTTTAATAAAAATGACTCGAAATCTACAACAGAGATAATTGGGGAGCTTACTAATGGACATACTGAAAAAATAGATAATAACAAGGATATAAACGTCGAATGTCCTAAAGAAGTGACAGCTAGTGAGGAGACTGAACTGCACAAAGATCTTTCTTTATTAGATCCACAGGAGGTTGTAGCGCCTGTTCCTCAAATTATCCAAGTAATTGAAAATGCGGAACCATTTGATGAGGTAGTTAGAATAAGTAAAGAAGAAGAATTCAAAAGAGGAAATGAAGATTTGTCTAAAGAACTTTGTACAGAAGGTCTGAGCGAAGAGATTGAGGTTATTGAAAAAGATAAATATAATGAAACGTTAGAATTGGAAAAACACGCCTCGACTAATTTACTTATACCCAATTTTAGTAGCAATACTGATAATTTTACGCTAGAAAAACCAACCAACCAACAAGATGAAAAAACTTTGGTTCAAACGAACAATAAAACGATAATATCAGAAGGACAATCTTTGGAAAATACTCAGAATACGGTTGCATTTAATACCGATCAAAGTTTTCTTATAGTACACCTGGAGCAATTTATCTTTGATGAAGTATCCGATGTGGTTCAGCAAATATCAGATTTAACGAACGTTGAAGAACTAAAAGAAATTCTACATACGGCAAAAGAATTACATGAATGTTTAGTTAAGTCAGAGAATGCTCTTGCTGCAGAATCTGTACCACTCCAAAATGTAAAAACACACAAGTCACTTCTTCAAAAAAAATTGCAAGAAGGTCTTTGTATTTTGCACAATGTAACTTTGGAGCGCGCCCAAACGCTAACTTCAGAAATCAAATCTGACAATTTGCAGAAACTCTCAGAAGTGATAACATATCTTCAAAAAGACTTAGAAGCTGTTTCCTCAGAAGTTGGATCAGAGGAAGTTTCAGAGAATGTGCGAACATCAGAAACGGATTCGATGAAAAGACTCAAAAACTTGTTGCAAGACGTCAGTGATGAAACAAATGTTTTACTTTCTGAAAAAAGTCATGAAAACAATGAGAAACTTAGAGATACCTTAGACGAAGTACAGACAGTCATCATTAAGCTCAAACGTGACTATGATTGTTCTGCAGTTGACACCCTCAATGAAACTCTTGAGGATTTAGAGTGCAGTGTGAGAAGTGTCCAACTTCAGATCAATGAAGAAAGCCCTCCTGAACTTTTGCAGGAAGCGTGTGCGACCTTAAACTTACTTGTTAATAATATGAATGAATCTAAAGTTAGTCTCTTAAACGAAAGCTCCACGATAAAAGAGATCAAAGATCATCAAATACTAAAAAAATGTTCCGAAGACGTTAATCAAACAGTCGAGCTTTTGGAAGATGTGTCCACCATCAAGGCCCCAGAAAAAGAAACGTTGGTTGAACGTGGTATAGATGCCTTACGGAGTCTTGATGAAGTTGAGGAAAAAGTATTTACATTAGAAAAAGATATCGAAAGCGAAATTAATATACCTACTGATATCCGTGAAAATATTTGGACTGCCGTACATTCCGTATATGGAAGTATTTCTAATATGAGAGGAACTATTTCTAGTATACAAAAACAGTACATGTTTGAAAATTATGGTAAACCGACCGATAACCTTTTAAAGTCAATAAAGAATACAAGAATTATAAGTGAAATTGATTCTGAAGATAATCAAACAAAATGGAAAAGATTTTCTAAAACTTTACGTAATGTTCTGAACCATTTCGAGGATATCAAATTTTATATAAGCCTTGATAAGACTGCTAGACTACCTAGTGATGCTGCTTTTACGAAAATCATATTGGAAGATTTGAAAAATAATATAAACGAGATAATAATTGATCATGAGAAGTTGGCATCTTGTAACAATAAAGAAAAGATGTCGGGAGCTCTGGATATTGTCACTAAATATTTAAAAAAAATTGAAATTCAAACAAGTCTTGAAGTAAAAGAAAAGATCCCAATGTTCTGTGAAATAGCACCTCAAGTTTTACAGGCTACAGAACTGGTGCTAGCTAAATTTACAAAATGTATCGATCAGGAATCTAATGAAGTTGAAATTAAGGATAATACATTACAATTGAAGAATGACCAAACGGTACGAAATATGTCCGTATCGAAAGAGGACGAATTTTTCACAGAAGCTATAGAAATGGAAACCATTACAGAACAAAAACAAACAGACCAAACAAATGAGTTGGTAAAAGAAAATATTCAGGAAACGTCTCAAACCGATTCAAAAGATTTGGACGTGACGATTGAAAAGTTTGGTAATGAGGAAGTTGGTGCAAAAGATCGTAAGAAATCTTTCAGTTTAACTGCTTTAGACGAACAAAGTGAGGAGCAATTTCCTAAACTCGATAAATCTAGTGATAAAAATCAAAATCAGGAAGCAACTACCTCCTATGCTGATATGACAGAAATTAAGGAACAGAAGGCTAAACCTACTGATGAGGAGATACAAAACGAAGATGGTCATTACCTGGTTAAGGAGAATAAAAAACAAAACAAGGCGGATACAGAAATCGGAAAAGTAGAAAAACAGAATAAACAGGAGGTTGACTTTGTTAAGGACCAAATAGAAATGGAACTAAATGAAAAAAATGCTTCTGCAATTGAAGAAAAAACTGAGACCACTATCTTACCGGTGAAACTTGAACAAGAGCAAGTCGACGAAAGAGAACTTGCAAATAAAGAAGAAGAAAATCGAAAACTAGAGGTATCCACTGCCAGGAAAAAGGCAGAGGCTGATAGTAAAAAGATTCAAGAAGAGCAAGGAAATAAAAGCAATGAAGAGAACAGTTATACAGCTAAGGAGAAAACAAAACAGGACCAAAAAATAACAGAGTTCAAAGAAGAAGAAAAACAGGAAATCCCAGAGGTTGCAGACGACAACAAACCAAACGCAGAAAACATTCTCCTAGTCAAAAGAACGATAAAGGATGATAACAATAAAACAGAATTAGGAGAAGATCAACAAAAAGGAGAAACAGCTCATCTTATTAAGGAGAAAGCAAAAGCGGACAAGAAAAGAGCAGAACTTGAAGACGAAGAAAAACCTGGTGAAGAGGTATCTCTTATTGCCAAGGAGAAAGAGGAAGCAGACAAGAAAAGAGCAGAGTTGGACGAACAAGAAAAACGGAGTGAAGAGGAAGCTCGTCTGGCCAAGGAAAAGGCGGAAGCAGACAAGAAGAGATTAGAGCTGGCAGAACAAGAAAAACGTACTGAAGAAGAGTCTCGTCTTACCAAGGACAAGTCGGAAGCAGACAAGAAACAAGTAGAGTTGGAAGAACAAAAGAAAGGTAGTGAAGAGGAATCTCTGCTTGCCAAGGAGAAGGCGAAAGCAGACGAGAAAAGAGTAGAGCTGGAAAAACTAGAGATACCTAATGAAGAGGAATCTCCTCTTGCCAACGAGAAGGCCGAAGTAGAGAAGAAAAGAGCCGAGCTGGAAGAACAAGAAAAACGTAGTGAAGAAGAATATCGACTTGCGAAGGAGAAGGCGGAAGCTGGCAAAAAGAAATTAGAGCTGGAAGAACAAGAGAAATCAAAAGAGGAAGAATCTCTTCGTGCCAACGAGAAGGTAGAAGCAGACAAGAAAAGAGAAGAACTCGACCTCGAAGAAAAACGCAAGGAAGAGGAAGCTCATCTGGCCACGGAAAAGACAGAAGAAGACAAGAAAAAAGCAAAACTTGAAAAAACAAAGAAGAAAAAAGGAGAACAATCTCGTCTAGCTAAAGAAAAGGTGGAAACAGACCAGAAAAGAACAGAGGTCGAAGATGAAGAAAAACGTATAGAAGAAAAAGCTCGCCTTGTGAAGGAAAAGGCGGAAGCTGACAAGAAGAGCTTAGAGCTGGAAGAACAAAAAAAACGTAGTGAAGAAGAGTCTCGTCTTACCAAGGAAAAGTCGGAAGCGGACAAGAAACAAGTAGAGTTGGAAGAACAAAAGAAAGGTAGTGAAGAGAAATCTCTGCTTACCACGAAGAAGGCGGAAGCAGACGAGAAAAGAGTAGAGTTGGAAAAACAAGAAAAACTTAGTGAAGAGGAAGCTCGTCTGGCTAAGGAGAAGGCGGAAGCAGACAAGAAGAGATTAGAACTGGAAGAACAAGAAAAACTTAGTGAAGAAGAATCTCGTCTTGCCAAGGAAAAGGCGGAAGCAGACAAGAAACGAGTAGAGTTGGAAAAACAAGAAAAACTTATTGAAGAGGAAGCTCGTCTGGCCAAGGAGAAGGCGGAAGCAGACAAAAAGAGATTAGAGCAAGAAGAACAAGAAAAACGTAGTGAAGAAGAATCTCGTCTTGCCAAGGAAAAGGCGGAAGCAGACAAGAAACGAGTAGAGTTGGAAAAACAAGAAAAACTTAGTGAAGAGGAAGCTCGTCTGGCTAAGGAAAAGGTGGAAGCAGACAAGAAGAGATTAGAGCTGGAAGAACAAGAAAAAATTAGTGAAGAAGAATCTCGTCTTGCCAAGGAAAAGGCGGAAGCAGACAAGAAACGAGTAGAGTTGGAAAAACAAGAAAAACTTATTGAAGAGGAAGCTCGTCTGGCCAAGGAGAAGGCGGAAGCAGACAAAAAGAGATTAGAGCAAGAAGAACAAGAAAAACGTAGTGAAGAAGAATCTCGTCTTGCCAAGGAAAAGGCGGAAGCAGACAAGAAACGAATAGAGTTGGAAAAACAAGAAAAACTTAGTGAAGAAGAATCTCGTCTTGTCAAGGAAAAGGCGGAAGCAGACAAGAAACGAATAGAGTTGGAAGAACAAGAAAAACGGAGTAAAGAGGAAGCTCGTCTGGGCAAGGAGAAGGCGAAAGCAGACAAGAAGAGATTAGAGCTGGAAGAACAAGAAAAACGTAGTGAAGAAGAATCTCGTCTTGCCAAGGAAAAGGCGGAAGCAGACAAGAAACGAGTAGAGTTGGAAGAACAAGAAAAACGGAGTAAAGAGGAAGCTCGGCTGGCCAAGGAAAATGCGGAAGCAGATAAGAAAAGATTAGAGCTGGAAGAACAAGAAAAACGTAATAAAGAGGAAGCTCGTCTCGCCAAGGAGAAGGCGAAAGCAGACAAGAAAAAAGCAAATCTTGAGAAAACAAAGAAGAAAAAAGTAGAACAAACTCCTCTAGCTAAAGAAAAGGTGGAAACAGACCCGAAAAGAACAGAGGTCGAAGATGAAGAAAAAAGTACAGAAGAAGAAGCTCGCCTTGCGAAGGAAAAGACGATAGCAGACAAGAAGAGATTAGAGCTGGAACAACAAGAAAAACGTAATGAAGAGGAATCTCGACTTGCCAAGGAAAAGGCGGAAGCAGATAAGAAAAGAGTAGAGTTGGAAGAACAAGAAAAACGTAATGAAGAGGAAGCTCGCCTTGTGAAGGAAAAGGCGGAAGCAGACAAAAAGAGATTAGAGCTGGAAGAACAAGAAAAACGTAATGAAGAGGAAGCTCGTCTGGCCAAGGAAAAGGCGGAAGCAGACAAAAAGAGATTAGAGCTGGAAGAACAAGAAAAACGTAGTGAAGAAGAATCTCGTCTTGCCAAGGAAAAGGCGGAAGCAGACAAGAAACGAGTAGAGTCGGAAGAACAAGAAAAACGGAGTGAAGAGGAAGCTAGTCTGGCCAAGGAGAAGGCGAAACCAGACAAGAAGAGATTAGAGCTGGAAGAACAAGAAAAACGTAATGAAGAGGAAGCTCGTCTTGCCAAAGAAAAGGCGGAAACAGACAAGAAACGAGTAAAGTTGGAAAAACAAGAAAAACTTTTTGAAGAGGAAGCTCGTCTGGCCAAGGAGAAAGCGGAAGCAGACAAAAAGAGGTTAGAGCTGGAAGAACAAGAAAAACGGAGTAAAGAGGAAGCTCGTCTGGCCAAGGAGAAGGCGGAAGCAGACAAAAAGAAATTAGAGCTGGAAGAACAAGAAAAACGTAGTGAAGAAGAATCTCGTCTTGTCAAGGAAAAGGCGGAAGCAGACAAGAAACGAATAGAGTTGGAAGAACAAGAAAAACGGAGTAAAGAGGAAGCTCGTCTGGGCAAGGAGAAGGCGAAAGCAGACAAGAAGAGATTAGAGCTGGAAGAACAAGAAAAACGTAGTGAAGAAGAATCTCGTCTTGCCAAGGAAAAGGCGGAAGCAGACAAGAAAAAAGCAAATCTTGAGAAAACAAAGAAGAAAAAAGGAGAACAAACTCCTCTGGCTAAAGAAAAGGTGGAAACAGACCAGAAAAGAACAGAGGTCGAAGATGAAGAAAAACGTAAAGAAGAGGAATCTCGTCTTTCCAGAGGAAAAGCAGAAATAGGAAAGAAACAAGCAGAGCTCGAAGAGGAAGTAAAACGTACAGATGAAGAAGCTCTTATAGCCAAAGCAAGAACAGAAGAAGACCAGAAAAAACCAAGAGCAGACAAAATAAAGGTTGGAAAAGACGACAAAGCTCAGCTAGCTAAAGAAAATGTAGAAGCAGATAAAAAAAGACGGAAAAGTGGATTTGAAGACAAATACAGGGGACAGGAAGCCGGTAACGCCAAGGAGAAAGCAGAAGCTGATAAGAAGAAAGCAGAGGTCAAAGATGGAGAAAAATACAAAGAAGAGGAAGCTCCACTTGCTAACCAGAAGGCAGAAATGGACGAGAAAGAGAATAAAACAGATAACGAAATAAAAGGCAGCGAGAATGTGGCTCAACAAATTAAGGAAAATTACGAAATGGACAAGGAAAAAACAAAAATTGGAATGGTTACTAAGAGGAATGATGATAAAGCTTATATTTCTATGGAAAATATGGAAGCAGCAAGAAAGTCAGAACTAGGAGAAAAAATACAAAGTCATCTTGGATATGAGAAAGTTCGTAAAGTAGAGTCAAAAGAACAAATTGAAAATGATGAAACTCGATTTAAACTTAGCATTGACAACCAAGACAATACGGTACTGGATTATGATAATGTTATGTACCAGGAGAGCAAATATGGAGCTATCAAGAAAAATGCTCACAAAACTGATAGAAATGGCGATGTCAAAAGAAAATACGAAGCAAGCTATAATCAAGAAAAAAATTCATCTCGTTTCAATGATAACGAACATTACATTAAGGAATATCAATATGAGCCTGGACCATCTCATACTAAAAGCAACGATTGGGATAAACATAGATTTGTCGATCACAGTCACAGGGATTTCTCTATGGAGTTTGCGAAACCATCTAAATATCGTGAAAGGTCTTTCGAAAATCGTTATTGTGTCGACAAAGATTATTCGAGTTTGAATAAAAATGCAACAATTTATAAGGCGCAAACTATTAACCTTGACGCTCAATTAAGATCTTCAGTGCCACCACTGCCCCTTGAGTCTAGTAGAAGTAGTGAACCAACAGAAAGACGTCCAGATATGCGCCATAGATCTAAAGCTTTCAGTGAGGCCAGGAGTGTGATTTCCGAAAAGCGTACTCTCTCGCGAAATTCTACGAGAAAACCTGTATTTTCTACCTTCCTAACTGACAGAACAGCGGTGGAAGGCTCTCGAGTAAAACTAACCTGCAGCGTCATTTCATCATCTGATCCGACAGTGACATGGTACAGGAATGGAGTACTTTTGGATAACAAACTAAAATACAGAAAGAAATTAGTTGATGGGTTGATAACTTTGGAAGTTCTGAATGCTGTTCCCAGCGACTCGGCAGAGTACAGTTGTACTGTTGAAAATGAAAATGGAGCCATCTCTACATCTGCCAATTTAAAGGTGTATCCAAGTTTTGAAGCATCTCCCATTCCACCTACGTTTACACGATCCATTCGTGATACTTTTCATCTTGCGGAAAACGAATTAGTACTGGAGTGTCGAATTCGAGGCCAACCTCTCCCAAAAATAACGTGGTTTAAAGATGACAAACAAATACCTTCTGACGGACGTTATCAAGCTTTCTATCTCGCTGATGGCGTGTGCAGACTCGCAATAGATAATCCAACTCCTGAAGATAGCGGAACATATACGTGCAAAGCTGAGAATTCGGTGTGGACTGATCAAATAACACATTTTGTCAACTTTACCGGAAGGGAAAGTCAAGTAAGTCCTAATGTGGTAACAGCTGAAAAAACTAGAATTGCACGTCAATCGCTAGAGTCGCGACGTCCTCATTTCGGCAACGTTTTGACGGACTATCAAGTAGCTAGAGGAGGTACTATTGGGCTGCAAGTTGAAATACGTGGGTGCCCGACCCGAGTGGAATGGCTTAGAGAAGGTAGATCCGTGACCGAAGTATACAGGAACGCTAGAGTTTTTGTTGAACAAGGGCTTTATACATTGGCTCTCTCTGACGTCACTGAAACAGAATCAGGCTTATACACGTGTAGAGCCTGGAGCGCCCACGGGAACGTGGACATGAATGCGGCTATAACAGTCGTTCAGCCGAGCGACCTTGATGGCAAACCAGCTGTTATTGTTGGTAGACCAGAAAAAGACATTCTCATATCTGTAGGCGAAGACATTAACATTTCCTTCAGAACGCAAGGTGAACCTAAGCCAAAAGTGATATTTATGAAGGGAATAAGGGATATAACTAACAGTCAACGTGTCTGTAAAATGACTTCGGACGACTACGTAAAGTTCACTCTAAAAAGGTCTGTTGTGTCGGATGCTGGCACTTATTGCATTTTGGTCAGAAATGCATATGGATGTGACAGAGCTTTCGTTACTGTTGTGGTGAGACAACGGGCCTCTTCTGAACATTTAATTTCCGACTGGACTTACCCACTCGATGATTCCGCATTGTCTATTGCCGATCGCAAGTATAAATCTGTGCCCGAGCGCATCCCGGGAGAGCCGTGCGTCGTCGACGGAGGAAACAACTGGGTGTCTCTCGCTTGGCCCAAGTCCGACCCCCAGACAACAGCTCCAGTGTTAGCGTACAAAGTCGAAAGTTGGTTGATCGGCGCGGAAGGAGGAGCGCGTTGGGTTGAACTTGGCATCACACCACTGAACTCATTCGACGCATTTAACTTAAAACAAGGCGAAGAATACCACTTCAGAGTGACTCCGAGAAATCGTTACGGTTGGGGTGAATCTTCGCAGACCTCTTCATCAATCGGCGTCGGTCTGGCCGGGGACAGACCGGAGTTCGTTGACATACTGCCTGGGCAGCTAAAGATTTTGGCAGGAGAAACGGCGAACTTGACCTGTAGCGTGAAAGGCAAGCCGGTGCCAGGTGTGGTGTGGATGAAGAACGGTCATGAGGTCGAGGAGGAAGCCGGACGAATGACGTCACAATTCAACGGATTCGATTGTTGCCTCACCATTAAAGATATTAACATCGACGATGAGGGTCGGTATAGCTGCGAGGCAACTAACACACACGGCAAGGCTTCTACTTACGCAAGATTGGCGGTCGTCACTGACAGAACTGTCTGGGAAGCAGATGCGAAACTCAAAAGAGAGAGATCTGCTGAAGTAGAAGGAGATTACCCACCGCAGTTCACGATGCGTTTGAGAGACCGTAGAGTGCAAGCAACGTATCCAGTGCGACTCACTTGCCAAGTTATAGGCAGTCCACCGCCCAAAGTCTCCTGGTACAAAGATGGAGAGGAAGTGGTGTACGACAAACGCCGCAATAAATACCAAGACGAGCAGTTCCACACGCTCGAGATTGCGCCGACGAACCTGGATGACGGAGGCGTGTACGAAGTGACGGCTAGGAACAACAGCGGAGCTGTCAGCTGTCATTGTGGACTGGTCGTGGACAAGGGCATCAGAGCGTACGTGGCTCCCGAGTTCTGTTGCGGCTTGGAGCCGTTGTACAAGCTACACGAAGGCGATGAACTCCGAATCTCAGCTGTAGTAGAGGCATACCCCTCGGTGGGTGTTACCTGGTATCGTGACGGAGTACGTCTGAGACCCAGTAGACGAGCAATCATGACCTTGGACAGAGACGGACAGATAGAACTGGCTTTAGCAGCCGTAACCACGAGAGACGCTGGAGTCTACACGTGTACCGCGTCCAATGAGGTCGGCAGAGCTTCGACCTCTGGGAAGGTTGAGGTCATTGGGACAGATCAGACGTCCGAACCGAGAATACCTCCTGTCGTTATCAGTCCTGATGTGCCATATTCAAAAGAACCAATGTTCATCCGGAAGCCGAGATCCAGTGAGGCTCGCGAGGGTGACACGGTCATCATTGAGTGCGAAGTGGTTGGAGATCCGAAGCCCGACGTGTATTGGCTCAGGGACTTCTTGAAACCGGATTACTACCGTGACGCGACTCATTTCAAACGCGTCGGAGATGGGCCGGAGTACAGATTTGAGATACCTCACGCGAAATTGAACTATACCGGAGCCTACTCTGTAGTGGCGAGAAACGTCCACGGAGAAGCCAAAGCGGTCATCTCCCTTCAGATCAAAGTTAAAGATATAAGTTCGACAGAAGAAGCACATCACATCAGATATGGGCGAGTCGAAGTGTTACCAAGATTCGAACGAAACCTGACCGACATGTTGTCTTGCGATGGCGATACAGTAGAGTTCGAATGTCAAGTTACTGGCAACCCCGATCCGGATATTAGATGGTTCCATTATGCTGAGGTGATCAGGGATTGCGCTGACTTCGAGTCTTCGTACGACGACGGTACAGCGAGGTTGAAGATCAAACAAGTTACCGCCGAAGATGAAGGCACCTACACGTGTGAGGCTTCCAACTGCCTCGGCAAAGCGAAGTCGAATGCCTGTCTCGTTGTTTATCCACCTGGTGAGCCGAATACGTTGTGCCAGCGACTCCGTCGTCCGCCAGCGCTGCTCTCAGCTGCCTCTACTCCTCGATCCACGCCGCGCAGTACACCGGCCAGATCAGTCTCCAGGACCCGGACGCCAGGTCCAGACACACGGCGTCTTTCCAGTCCAGGCCGTCAAATGGCTCCGACTTTCTACACTTATCCCTTCAACAAAGTGGTGGAGGAGGGCGAAAACGTGACCTTCAAGTGCGCCGTCAAAGGGAACCCTTCGCCCTGGGCCTCATGGGACAAGGACGGCTCCATAATCACGCCTTCAGCGAGAATAACTGTCAAGGAGAAGGAGGAAATAATGAGAATTTTAGAAATCGATGAGGTTTCGATAGAAGATGTCGGAATTTATCGGATAACTGTTGAGAACGAGCTCGGTAGGGCCGAGGCGTCTGCGAGACTCGAGGTGATCACCAGGTCTGGGAAGTTTTATGGAGGATTGAGAGCATACAGCGCATCGCCAAGGAAGTGTCTCTCGTACCGGAGACGACCCTCCACTCCGAGGCAAGACTGA
Protein
MWENETKPLDVASWEPQKSLLIKSQSRAGASLDDRFVSTEEAGGVRLTVSTARTGDTGVYTLQASNAAGSDTARVRLEVSAEESPSGEDPPTFLRRLQDLTVKVGTRTRFLVEIISSTECKVTWYRNERRLLEAERVSIVRDGSFFCADVAAVSVDDAGRWTCTAENVGGRASCSAHLNVLVPKAYKRPEFVEELRALLTEQGTVSLECKVVGVPTPVLRWFKDSREIKAGDVFALTANAEDPTSLGTYTCEAVNCMGRAYSSSKVHVVGRASREGSLKPNSSGLSPEPPPIFTRELEDQYVRICEPFTLSCQIVVPPWPRSVVWYNKEGKVEAGERYHVLEDGVGGYVLEVRSAEWRDEGEWKCVATSSGGRVGISTCSLNMDVPKNYRKPRFMENLQAVLTEEGLVSFECKVVGFPTPVLSWFKDGQELKPGDVYQLTGTNSLGSYCCIAKNCMGQASSSAELTVEDIQNQLNEEEKLQLFSKNQAPKFVHGLKSVEAKIDEPFRFTIKVAIPPEPSLLWYRDDQPVDESSRCHLGKEERGVFFLDIQALEFLDQAEWKCVAFNDFGQSVTSCFLKLIIPRHYKKPRFLENLQAILSDEGAVNLECKVIGVPQPVLKWYKDGEELKPGDIHRIISGQDGTCSLGTYTCEASNCMGVAASSASLLGFEESMKAKEKKKAEEQALQRNLSLSTIHEERTSQMYDTPVGDITLDDKGEVSFSFDGKEVSVSLYETPDLTEEEALQIVEMYADQLSENVTEHNVVELPPLRFVKETSTSGNLLMEALVIDVSPEYFASPEEDLRTEADVEDISIADENGLPQLSLDQEIDIAGEDYLEKTMALLSEEKVDIPLTLGRKKSDSQKSGEDYFSLSREQSLSEEKKDDDTQVMSESELQSFASAHSSGKPKSKSSKPSGEDGHESSDLTKTILLRDDMQKPTESDVKTSARKTKRERRSSRGSSGSEKSVDKFKDELIKEQTIIATETEMEGKQVMTNEEFRVSMTNVSTSLNKVINDIEKIEKEIIIKSELMASAATASKSLEIISSLINPLSEILSITDTIQESASETIEVQRTLFSRLPKPLKVLQQTLTIIEKCIDVESDNRTLVKKTCVSIMEKCGNAIQNLVSEINAIEKKEYLLLSENVCNELDVVSNEISTVVNFSTESIKTNNLLNETTEVKLESTVESKHLTDTQKALFELKGPLRSLLYIVDSAESGKIVDISQVNNSEVILNDMSASIQDLQSALEQIESLSVLECATSLNKYNTEIIENVMEPVLQLRSSFEKMSTEIKAEDKIQLNKVLSSIKENLTVISSYINKVENNIGAFDVLQNENKLEALQKMAETLISLEKNLPTLDTMPQVQGNMNSFHKNLTKALEKVIESNNANKYLSMIEICDGIRRINSCIRDMDTDNILSLASLSNTLKIIQNQFIKNIFDSELNCCVVTNITDILIGIQETINQAQEFTTEIQYDNFQDTQAPIFDSTKVEIIVEHVNQTVAAINQVKLLETTSSLKENITPTLQKICPILEELKQNIASACVGGIQKEAYVSDISEKSFSEKFAVPLSELNHNVIVLNQTIIENIESLKESNEIVTAIAEPLQELFRTLEVIQQDVISQFGPDLSPYEISVDIASIIQSLQSCVVMIQDHAAIEVVDDMSTLEDISGIKTTAETASADQLVLPTAEFATTEQTLGSFYDEQPKSSIAQALHVLNEHLTILQSPEIIDAIDTLSEISDYSSLKSVTLGLSDLHSGIEEVLQPIVLEGLQSINASKLAAMAEPMQVLQHSLSVVDPNNIPIYENILELLTDNIHSVLNKINAFKEHLDKCMQAILPALEFTKQSIEISSSVNKLREACQHLKIMLKSINQSSTTQIPEVQVLDDVVNEILIATDVTEGIKIEQVRYLSEELYARVAGVREEILRFTPNSSEALPNEASFIHTIEEVEHNIAVLEEYDFVDLSRASELSSCASPQIAKEVEIESLVHISEIVETAVRIIKDAGEDTPMADLMIVEDFFTTCKNEFTILRCLLNKSMSPKKIIRLVQEFCNIQSTIQGFKTKTNELQLSDDVNQCIESFLIHSDDCLATVRQSLIKIVESQSELLFKSPIVNLKYLSHRNHFDKMANLVAKLDDFVDAVKPNAENIKDKIIMELKNLDLCNVNNEENKLVRTMDDFFRFVEDEIVVQEDNDKKVILKKILTCLEKHQDYKDATDAGKVLIIMHCLSNCVDILQESLGETKQKIECDTNDEALDIKAALMEMVEPLQNLHTQLIHVQEVVLSGVQEDSISLDIDSAESIVQTISDVHKKISAKLELETVNVSDKDVALIFEVDKDLHAIQDSIKALKNQPAAQDIKDVTKQIQDVEKSLHVLVASENVITDVKDKIPKGSTEQLVQHINQYIELIEIVEEISAVIEIEDLKETIEMAKDLRETFVTSDMINDEVAESIKEEILIEQARLAHKLQKAISALQVQVFDSAQEMVPELSTEIFQRVARVTAQLQADLMAVTGVHITIQAPPYVLDEVAKSLETISTENRLVPESAQGDKLVSIVENVNMFENTADPPIQPKPKELSNITVEPEEVNITQLLEDVSSNERVINENLVTVTQEVAVAQMETNMDIAGVTKKTQDGLIKDDIKSFSISEEAQSIFEQGSPEVYNVLNAEELASNQTFSADSASNNMPDNELDIVEPVLVCSVPASSLDDLEGSVNPKTGLVTDEKIDLQKVDVTIEMPEIAQLDKCQPFYAKLVEHLDEYVNENIIEIVDEFSCSANLHELMQSVDLAKQLQKSITISESVIEPNIETEPNPQSPVYLASQLKMALLVLYNQELESLEVMAPHLTKDKLKVISEIVHNLCDDLTQVMEAVQSNQNTSESSVKESVQKANVVEQDLNSPEEIDEIFETKTPLQEVGTAQNIVSLEETSTDLLSEEKHETIDTAEIKSVVGKITDNLFSIEAAQSIEVKEDFSDVKSTDLRVTDSVTEVLESSDVRVIENVSSNTSCDTIDLPLNEDNYSIQTAHSTEVEPERLDSSVILGGISLKQVPDVMNLEMEEEEAFETLAGTTHETTENLMGENVCPIKNDEVNIEIIDTLISKEDNADIEQLKKNQPTSLESDDVPTNINLLVDDSLLEIDKAVKSTEALKNIPQRDLAENEQQLGEDTTGSKQKVVELPDTIDDVSQDMIVEHLPTSEVKLLEGQLLAAEENTLSEALKSSLVTVQKTTETPLDDTSVDLVKIAGEPEIKSKLVEELQTIADSKSQKMIEESTTRETVESPLITTGKTTETPNDITSMNVGETEKQRKESITELNQKSSDFTKSQSIVSDVSQEILVEHLISDEIKFTKEQQLAKEDLTAEVNLPLVTGHETIQTLNSNLENEMCESLKIEQAVSAETTESTVESQRVASEVILELVSEQLKKDQAESSNSQTAENIVREIVVTSEITALETLGLPLERSGNDGDLVELLSIETKQITVEPRATTYEVVAEQQVVPSGQQPVEAIDSMKKEPLDAMEILLTGAATSLLVTKNEIKEAKSDNTAEITKVEDEIAAEAEKEMVPKVICETTQDMAREQIEVEEVVDVKLLPSTIDQITYDNVVESLICTPLKTISNTLAENITSDVNSTVTNQEKLLKTEQVTVEMQLTENVKCEELCSKQLNNDQLEHLSTQPLVVENIPQTIAVESLTVATIDCTENLARDVNDVEDFEAASSIELNQETMQSQGIVCEIIEENLDKQIKSGEDSSLETFKYFQSTDAPVREAVESTVVSAIETTCELDENVQNDIVETVNIEEESSTKARRVIMESQGVVSEISDELCTEQLAIDETPESSLKTVLESYEILKDGNSSDVVEDKCQTVICEITEETVVEQLNEYQAPDLELKSAAAENVPTEAINSLVVTVLETTEIFTGDISNDASDSLTIQNIPSMSNLQIESAFETDLKQNQVNENFAAENVVSSEQQAPITAVEETLNTTDNVMSNIPTDDAPKPSALIACEEQYYVQITEPVVIDKTEPIEEFGSRIEAISPEDTGNEVILRESFDNAEVVEIVSVEAVSENAMVPYFELESADMLSSPDVLDSVEDKLASASEINETLKHHINRYLSDSIVKATQELFSVFNVNKLNQSINMAKCYSESVVVGGNSVLPTSKYSVNLLHHLDSAMRESLHEILENKDKIPLAENEILTNITDIQNLIIQDISLLIPALSMARVAHHDLDIGQSTHSDEELNLKVDSRKEVEYENPSFLGLAVQDFKTTLSSNLGENNTTVNSLENDAYVKVLAKNIQVENVVEKETKIEGKNDSQNVSEVEISKFVEAYEGEVIRCNEKENEIEDHFQSSSTEKIKSTQENSVINLEQTPVQVLEINTTNGVEGEINHETNLSGTCLDTSENGIDLIQRNLFSEKVIEDFEKSSPERDKFNSEMLNTRVIEVIALEELELCYEINNLKTKYPEYSEETSTLKEVNTNPREMNHSDEHNVAPDCKSSTKKDQFPNLIEAKIETVPVPVLKHFLTSHLTVFHELANLDSDLEQKNSEKIAMINEPQFVIFQNAIINDNIMKKSNATEKLVDQLSEKVQCRNVVVNENEIVIFNKNDSKSTTEIIGELTNGHTEKIDNNKDINVECPKEVTASEETELHKDLSLLDPQEVVAPVPQIIQVIENAEPFDEVVRISKEEEFKRGNEDLSKELCTEGLSEEIEVIEKDKYNETLELEKHASTNLLIPNFSSNTDNFTLEKPTNQQDEKTLVQTNNKTIISEGQSLENTQNTVAFNTDQSFLIVHLEQFIFDEVSDVVQQISDLTNVEELKEILHTAKELHECLVKSENALAAESVPLQNVKTHKSLLQKKLQEGLCILHNVTLERAQTLTSEIKSDNLQKLSEVITYLQKDLEAVSSEVGSEEVSENVRTSETDSMKRLKNLLQDVSDETNVLLSEKSHENNEKLRDTLDEVQTVIIKLKRDYDCSAVDTLNETLEDLECSVRSVQLQINEESPPELLQEACATLNLLVNNMNESKVSLLNESSTIKEIKDHQILKKCSEDVNQTVELLEDVSTIKAPEKETLVERGIDALRSLDEVEEKVFTLEKDIESEINIPTDIRENIWTAVHSVYGSISNMRGTISSIQKQYMFENYGKPTDNLLKSIKNTRIISEIDSEDNQTKWKRFSKTLRNVLNHFEDIKFYISLDKTARLPSDAAFTKIILEDLKNNINEIIIDHEKLASCNNKEKMSGALDIVTKYLKKIEIQTSLEVKEKIPMFCEIAPQVLQATELVLAKFTKCIDQESNEVEIKDNTLQLKNDQTVRNMSVSKEDEFFTEAIEMETITEQKQTDQTNELVKENIQETSQTDSKDLDVTIEKFGNEEVGAKDRKKSFSLTALDEQSEEQFPKLDKSSDKNQNQEATTSYADMTEIKEQKAKPTDEEIQNEDGHYLVKENKKQNKADTEIGKVEKQNKQEVDFVKDQIEMELNEKNASAIEEKTETTILPVKLEQEQVDERELANKEEENRKLEVSTARKKAEADSKKIQEEQGNKSNEENSYTAKEKTKQDQKITEFKEEEKQEIPEVADDNKPNAENILLVKRTIKDDNNKTELGEDQQKGETAHLIKEKAKADKKRAELEDEEKPGEEVSLIAKEKEEADKKRAELDEQEKRSEEEARLAKEKAEADKKRLELAEQEKRTEEESRLTKDKSEADKKQVELEEQKKGSEEESLLAKEKAKADEKRVELEKLEIPNEEESPLANEKAEVEKKRAELEEQEKRSEEEYRLAKEKAEAGKKKLELEEQEKSKEEESLRANEKVEADKKREELDLEEKRKEEEAHLATEKTEEDKKKAKLEKTKKKKGEQSRLAKEKVETDQKRTEVEDEEKRIEEKARLVKEKAEADKKSLELEEQKKRSEEESRLTKEKSEADKKQVELEEQKKGSEEKSLLTTKKAEADEKRVELEKQEKLSEEEARLAKEKAEADKKRLELEEQEKLSEEESRLAKEKAEADKKRVELEKQEKLIEEEARLAKEKAEADKKRLEQEEQEKRSEEESRLAKEKAEADKKRVELEKQEKLSEEEARLAKEKVEADKKRLELEEQEKISEEESRLAKEKAEADKKRVELEKQEKLIEEEARLAKEKAEADKKRLEQEEQEKRSEEESRLAKEKAEADKKRIELEKQEKLSEEESRLVKEKAEADKKRIELEEQEKRSKEEARLGKEKAKADKKRLELEEQEKRSEEESRLAKEKAEADKKRVELEEQEKRSKEEARLAKENAEADKKRLELEEQEKRNKEEARLAKEKAKADKKKANLEKTKKKKVEQTPLAKEKVETDPKRTEVEDEEKSTEEEARLAKEKTIADKKRLELEQQEKRNEEESRLAKEKAEADKKRVELEEQEKRNEEEARLVKEKAEADKKRLELEEQEKRNEEEARLAKEKAEADKKRLELEEQEKRSEEESRLAKEKAEADKKRVESEEQEKRSEEEASLAKEKAKPDKKRLELEEQEKRNEEEARLAKEKAETDKKRVKLEKQEKLFEEEARLAKEKAEADKKRLELEEQEKRSKEEARLAKEKAEADKKKLELEEQEKRSEEESRLVKEKAEADKKRIELEEQEKRSKEEARLGKEKAKADKKRLELEEQEKRSEEESRLAKEKAEADKKKANLEKTKKKKGEQTPLAKEKVETDQKRTEVEDEEKRKEEESRLSRGKAEIGKKQAELEEEVKRTDEEALIAKARTEEDQKKPRADKIKVGKDDKAQLAKENVEADKKRRKSGFEDKYRGQEAGNAKEKAEADKKKAEVKDGEKYKEEEAPLANQKAEMDEKENKTDNEIKGSENVAQQIKENYEMDKEKTKIGMVTKRNDDKAYISMENMEAARKSELGEKIQSHLGYEKVRKVESKEQIENDETRFKLSIDNQDNTVLDYDNVMYQESKYGAIKKNAHKTDRNGDVKRKYEASYNQEKNSSRFNDNEHYIKEYQYEPGPSHTKSNDWDKHRFVDHSHRDFSMEFAKPSKYRERSFENRYCVDKDYSSLNKNATIYKAQTINLDAQLRSSVPPLPLESSRSSEPTERRPDMRHRSKAFSEARSVISEKRTLSRNSTRKPVFSTFLTDRTAVEGSRVKLTCSVISSSDPTVTWYRNGVLLDNKLKYRKKLVDGLITLEVLNAVPSDSAEYSCTVENENGAISTSANLKVYPSFEASPIPPTFTRSIRDTFHLAENELVLECRIRGQPLPKITWFKDDKQIPSDGRYQAFYLADGVCRLAIDNPTPEDSGTYTCKAENSVWTDQITHFVNFTGRESQVSPNVVTAEKTRIARQSLESRRPHFGNVLTDYQVARGGTIGLQVEIRGCPTRVEWLREGRSVTEVYRNARVFVEQGLYTLALSDVTETESGLYTCRAWSAHGNVDMNAAITVVQPSDLDGKPAVIVGRPEKDILISVGEDINISFRTQGEPKPKVIFMKGIRDITNSQRVCKMTSDDYVKFTLKRSVVSDAGTYCILVRNAYGCDRAFVTVVVRQRASSEHLISDWTYPLDDSALSIADRKYKSVPERIPGEPCVVDGGNNWVSLAWPKSDPQTTAPVLAYKVESWLIGAEGGARWVELGITPLNSFDAFNLKQGEEYHFRVTPRNRYGWGESSQTSSSIGVGLAGDRPEFVDILPGQLKILAGETANLTCSVKGKPVPGVVWMKNGHEVEEEAGRMTSQFNGFDCCLTIKDINIDDEGRYSCEATNTHGKASTYARLAVVTDRTVWEADAKLKRERSAEVEGDYPPQFTMRLRDRRVQATYPVRLTCQVIGSPPPKVSWYKDGEEVVYDKRRNKYQDEQFHTLEIAPTNLDDGGVYEVTARNNSGAVSCHCGLVVDKGIRAYVAPEFCCGLEPLYKLHEGDELRISAVVEAYPSVGVTWYRDGVRLRPSRRAIMTLDRDGQIELALAAVTTRDAGVYTCTASNEVGRASTSGKVEVIGTDQTSEPRIPPVVISPDVPYSKEPMFIRKPRSSEAREGDTVIIECEVVGDPKPDVYWLRDFLKPDYYRDATHFKRVGDGPEYRFEIPHAKLNYTGAYSVVARNVHGEAKAVISLQIKVKDISSTEEAHHIRYGRVEVLPRFERNLTDMLSCDGDTVEFECQVTGNPDPDIRWFHYAEVIRDCADFESSYDDGTARLKIKQVTAEDEGTYTCEASNCLGKAKSNACLVVYPPGEPNTLCQRLRRPPALLSAASTPRSTPRSTPARSVSRTRTPGPDTRRLSSPGRQMAPTFYTYPFNKVVEEGENVTFKCAVKGNPSPWASWDKDGSIITPSARITVKEKEEIMRILEIDEVSIEDVGIYRITVENELGRAEASARLEVITRSGKFYGGLRAYSASPRKCLSYRRRPSTPRQD
Summary
Description
Serine/threonine-protein kinase (PubMed:18390597, PubMed:20346955). Key component in the assembly and functioning of muscles. By providing connections at the level of individual microfilaments, it contributes to the fine balance of forces between the two halves of the sarcomere. The size and extensibility of the cross-links are the main determinants of sarcomere extensibility properties of muscle. In non-muscle cells, seems to play a role in chromosome condensation and chromosome segregation during mitosis. Might link the lamina network to chromatin or nuclear actin, or both during interphase (By similarity).
Structural component of the muscle M line which is involved in assembly and organization of sarcomere myofilaments (PubMed:15313609, PubMed:16453163, PubMed:18801371, PubMed:22621901, PubMed:23283987, PubMed:27009202). The large isoform a, isoform b, isoform d and isoform f play an essential role in maintaining the organization of sarcomeres but not myofilament alignment during body wall muscle development whereas the small isoform c and isoform d appear to have a minor role (PubMed:15313609, PubMed:16453163, PubMed:22768340). Isoform b and isoform f are required for the organization of unc-15/paramyosin into sarcomere thick filaments in body wall muscles (PubMed:27009202). By binding mel-26, a substrate adapter of the cul-3 E3 ubiquitin-protein ligase complex, regulates the organization of myosin thick filaments, likely by preventing the degradation of microtubule severing protein mei-1 (PubMed:22621901). Acts as guanine nucleotide exchange factor (GEF) for Rho GTPase rho-1 but not ced-10, mig-2 and cdc-42 (PubMed:18801371). The large isoforms regulate Ca(2+) signaling during muscle contraction by ensuring the correct localization of sarco-endoplamic reticulum Ca(2+) ATPase sca-1 and ryanodine receptor unc-68 (PubMed:22768340). By controlling the contraction and/or organization of pharyngeal muscles, plays a role in the formation of pharyngeal gland cell extension (PubMed:21868609). In contrast to obscurins in other species, unlikely to have serine/threonine kinase activity as both protein kinase domains are predicted to be catalytically inactive (Probable).
Key component in the assembly and functioning of adult and embryonic striated muscles and muscle tendons. By providing connections at the level of individual microfilaments, it contributes to the fine balance of forces between the two halves of the sarcomere. The size and extensibility of the cross-links are the main determinants of sarcomere extensibility properties of muscle. In non-muscle cells, seems to play a role in chromosome condensation and chromosome segregation during mitosis. Might link the lamina network to chromatin or nuclear actin, or both during interphase.
Key component in the assembly and functioning of vertebrate striated muscles. By providing connections at the level of individual microfilaments, it contributes to the fine balance of forces between the two halves of the sarcomere. The size and extensibility of the cross-links are the main determinants of sarcomere extensibility properties of muscle. In non-muscle cells, seems to play a role in chromosome condensation and chromosome segregation during mitosis. Might link the lamina network to chromatin or nuclear actin, or both during interphase.
Structural component of the muscle M line which is involved in assembly and organization of sarcomere (PubMed:22467859, PubMed:26251439). Required for the development and organization of indirect flight muscle sarcomeres by regulating the formation of M line and H zone and the correct assembly of thick and thin filaments in the sarcomere (PubMed:22467859, PubMed:26251439). Likely to have serine/threonine-protein kinase activity as one of the two protein kinase domains appears to be functional (Probable).
Calcium/calmodulin-dependent myosin light chain kinase implicated in smooth muscle contraction via phosphorylation of myosin light chains (MLC). Also regulates actin-myosin interaction through a non-kinase activity. Phosphorylates PTK2B/PYK2 and myosin light-chains. Involved in the inflammatory response (e.g. apoptosis, vascular permeability, leukocyte diapedesis), cell motility and morphology, airway hyperreactivity and other activities relevant to asthma. Required for tonic airway smooth muscle contraction that is necessary for physiological and asthmatic airway resistance. Necessary for gastrointestinal motility. Implicated in the regulation of endothelial as well as vascular permeability, probably via the regulation of cytoskeletal rearrangements. In the nervous system it has been shown to control the growth initiation of astrocytic processes in culture and to participate in transmitter release at synapses formed between cultured sympathetic ganglion cells. Critical participant in signaling sequences that result in fibroblast apoptosis. Plays a role in the regulation of epithelial cell survival. Required for epithelial wound healing, especially during actomyosin ring contraction during purse-string wound closure. Mediates RhoA-dependent membrane blebbing. Triggers TRPC5 channel activity in a calcium-dependent signaling, by inducing its subcellular localization at the plasma membrane. Promotes cell migration (including tumor cells) and tumor metastasis. PTK2B/PYK2 activation by phosphorylation mediates ITGB2 activation and is thus essential to trigger neutrophil transmigration during acute lung injury (ALI). May regulate optic nerve head astrocyte migration. Probably involved in mitotic cytoskeletal regulation. Regulates tight junction probably by modulating ZO-1 exchange in the perijunctional actomyosin ring. Mediates burn-induced microvascular barrier injury; triggers endothelial contraction in the development of microvascular hyperpermeability by phosphorylating MLC. Essential for intestinal barrier dysfunction. Mediates Giardia spp.-mediated reduced epithelial barrier function during giardiasis intestinal infection via reorganization of cytoskeletal F-actin and tight junctional ZO-1. Necessary for hypotonicity-induced Ca(2+) entry and subsequent activation of volume-sensitive organic osmolyte/anion channels (VSOAC) in cervical cancer cells. Responsible for high proliferative ability of breast cancer cells through anti-apoptosis.
Calcium/calmodulin-dependent myosin light chain kinase implicated in smooth muscle contraction via phosphorylation of myosin light chains (MLC). Also regulates actin-myosin interaction through a non-kinase activity. Phosphorylates PTK2B/PYK2 and myosin light-chains. Involved in the inflammatory response (e.g. apoptosis, vascular permeability, leukocyte diapedesis), cell motility and morphology, airway hyperreactivity and other activities relevant to asthma. Required for tonic airway smooth muscle contraction that is necessary for physiological and asthmatic airway resistance. Necessary for gastrointestinal motility. Implicated in the regulation of endothelial as well as vascular permeability, probably via the regulation of cytoskeletal rearrangements. In the nervous system it has been shown to control the growth initiation of astrocytic processes in culture and to participate in transmitter release at synapses formed between cultured sympathetic ganglion cells. Critical participant in signaling sequences that result in fibroblast apoptosis. Plays a role in the regulation of epithelial cell survival. Required for epithelial wound healing, especially during actomyosin ring contraction during purse-string wound closure. Mediates RhoA-dependent membrane blebbing. Triggers TRPC5 channel activity in a calcium-dependent signaling, by inducing its subcellular localization at the plasma membrane. Promotes cell migration (including tumor cells) and tumor metastasis. PTK2B/PYK2 activation by phosphorylation mediates ITGB2 activation and is thus essential to trigger neutrophil transmigration during acute lung injury (ALI). May regulate optic nerve head astrocyte migration. Probably involved in mitotic cytoskeletal regulation. Regulates tight junction probably by modulating ZO-1 exchange in the perijunctional actomyosin ring. Mediates burn-induced microvascular barrier injury; triggers endothelial contraction in the development of microvascular hyperpermeability by phosphorylating MLC. Essential for intestinal barrier dysfunction. Mediates Giardia spp.-mediated reduced epithelial barrier function during giardiasis intestinal infection via reorganization of cytoskeletal F-actin and tight junctional ZO-1. Necessary for hypotonicity-induced Ca(2+) entry and subsequent activation of volume-sensitive organic osmolyte/anion channels (VSOAC) in cervical cancer cells.
Promotes cleavage furrow maturation during cytokinesis in preimplantation embryos (PubMed:21215633). May play a role in the architecture of adhesive and flexible epithelial cell junctions (PubMed:17015624). May play a role during myocardial remodeling by imparting an effect on cardiac fibroblast migration (PubMed:24951538).
Promotes cleavage furrow maturation during cytokinesis in preimplantation embryos. May play a role in the architecture of adhesive and flexible epithelial cell junctions. May play a role during myocardial remodeling by imparting an effect on cardiac fibroblast migration.
Thought to be involved during neural development in axonal navigation at the ventral midline of the neural tube. In spinal chord development plays a role in guiding commissural axons probably by preventing premature sensitivity to Slit proteins thus inhibiting Slit signaling through ROBO1 (By similarity). Required for hindbrain axon midline crossing.
Cytoskeletal protein required for organization of normal actin cytoskeleton. Roles in establishing cell morphology, motility, cell adhesion and cell-extracellular matrix interactions in a variety of cell types. May function as a scaffolding molecule with the potential to influence both actin polymerization and the assembly of existing actin filaments into higher-order arrays. Binds to proteins that bind to either monomeric or filamentous actin. Localizes at sites where active actin remodeling takes place, such as lamellipodia and membrane ruffles. Different isoforms may have functional differences. Plays a role in neurite outgrowth and in the establishment of polarity during neuronal morphogenesis. Participates in the acquisition of the reactive astrocyte morphology.
In conjunction with another transmembrane protein, CNTNAP2, contributes to the organization of axonal domains at nodes of Ranvier by maintaining voltage-gated potassium channels at the juxtaparanodal region.
Displays low peroxidase activity and is likely to participate in H(2)O(2) metabolism and peroxidative reactions in the cardiovascular system (By similarity). Plays a role in extracellular matrix formation.
Receptor for SLIT2, and probably SLIT1, which are thought to act as molecular guidance cue in cellular migration, including axonal navigation at the ventral midline of the neural tube and projection of axons to different regions during neuronal development.
Structural component of striated muscles which plays a role in myofibrillogenesis. Probably involved in the assembly of myosin into sarcomeric A bands in striated muscle (By similarity). Has serine/threonine protein kinase activity and phosphorylates N-cadherin CDH2 and sodium/potassium-transporting ATPase subunit ATP1B1 (PubMed:23392350). Binds (via the PH domain) strongly to phosphatidylinositol 3,4-bisphosphate (PtdIns(3,4)P2) and phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2), and to a lesser extent to phosphatidylinositol 3-phosphate (PtdIns(3)P), phosphatidylinositol 4-phosphate (PtdIns(4)P), phosphatidylinositol 5-phosphate (PtdIns(5)P) and phosphatidylinositol 3,4,5-trisphosphate (PtdIns(3,4,5)P3) (By similarity).
Isoform 2 and isoform 3: bind phosphatidylinositol bisphosphates (PIP2s) via their PH domains and negatively regulate the PI3K/AKT/mTOR signaling pathway, thus contributing to the regulation of cardiomyocyte size and adhesion.
Core component of the 3M complex, a complex required to regulate microtubule dynamics and genome integrity. It is unclear how the 3M complex regulates microtubules, it could act by controlling the level of a microtubule stabilizer. Acts as a regulator of the Cul7-RING(FBXW8) ubiquitin-protein ligase, playing a critical role in the ubiquitin ligase pathway that regulates Golgi morphogenesis and dendrite patterning in brain. Required to localize CUL7 to the Golgi apparatus in neurons (By similarity).
Core component of the 3M complex, a complex required to regulate microtubule dynamics and genome integrity. It is unclear how the 3M complex regulates microtubules, it could act by controlling the level of a microtubule stabilizer (By similarity). Acts as a regulator of the Cul7-RING(FBXW8) ubiquitin-protein ligase, playing a critical role in the ubiquitin ligase pathway that regulates Golgi morphogenesis and dendrite patterning in brain. Required to localize CUL7 to the Golgi apparatus in neurons.
Core component of the 3M complex, a complex required to regulate microtubule dynamics and genome integrity. It is unclear how the 3M complex regulates microtubules, it could act by controlling the level of a microtubule stabilizer (PubMed:24793695, PubMed:24793696). Acts as a regulator of the Cul7-RING(FBXW8) ubiquitin-protein ligase, playing a critical role in the ubiquitin ligase pathway that regulates Golgi morphogenesis and dendrite patterning in brain. Required to localize CUL7 to the Golgi apparatus in neurons.
Structural component of striated muscles which plays a role in myofibrillogenesis. Probably involved in the assembly of myosin into sarcomeric A bands in striated muscle (PubMed:11448995, PubMed:16205939). Has serine/threonine protein kinase activity and phosphorylates N-cadherin CDH2 and sodium/potassium-transporting ATPase subunit ATP1B1 (By similarity). Binds (via the PH domain) strongly to phosphatidylinositol 3,4-bisphosphate (PtdIns(3,4)P2) and phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2), and to a lesser extent to phosphatidylinositol 3-phosphate (PtdIns(3)P), phosphatidylinositol 4-phosphate (PtdIns(4)P), phosphatidylinositol 5-phosphate (PtdIns(5)P) and phosphatidylinositol 3,4,5-trisphosphate (PtdIns(3,4,5)P3) (PubMed:28826662).
Structural component of the muscle M line which is involved in assembly and organization of sarcomere myofilaments (PubMed:15313609, PubMed:16453163, PubMed:18801371, PubMed:22621901, PubMed:23283987, PubMed:27009202). The large isoform a, isoform b, isoform d and isoform f play an essential role in maintaining the organization of sarcomeres but not myofilament alignment during body wall muscle development whereas the small isoform c and isoform d appear to have a minor role (PubMed:15313609, PubMed:16453163, PubMed:22768340). Isoform b and isoform f are required for the organization of unc-15/paramyosin into sarcomere thick filaments in body wall muscles (PubMed:27009202). By binding mel-26, a substrate adapter of the cul-3 E3 ubiquitin-protein ligase complex, regulates the organization of myosin thick filaments, likely by preventing the degradation of microtubule severing protein mei-1 (PubMed:22621901). Acts as guanine nucleotide exchange factor (GEF) for Rho GTPase rho-1 but not ced-10, mig-2 and cdc-42 (PubMed:18801371). The large isoforms regulate Ca(2+) signaling during muscle contraction by ensuring the correct localization of sarco-endoplamic reticulum Ca(2+) ATPase sca-1 and ryanodine receptor unc-68 (PubMed:22768340). By controlling the contraction and/or organization of pharyngeal muscles, plays a role in the formation of pharyngeal gland cell extension (PubMed:21868609). In contrast to obscurins in other species, unlikely to have serine/threonine kinase activity as both protein kinase domains are predicted to be catalytically inactive (Probable).
Key component in the assembly and functioning of adult and embryonic striated muscles and muscle tendons. By providing connections at the level of individual microfilaments, it contributes to the fine balance of forces between the two halves of the sarcomere. The size and extensibility of the cross-links are the main determinants of sarcomere extensibility properties of muscle. In non-muscle cells, seems to play a role in chromosome condensation and chromosome segregation during mitosis. Might link the lamina network to chromatin or nuclear actin, or both during interphase.
Key component in the assembly and functioning of vertebrate striated muscles. By providing connections at the level of individual microfilaments, it contributes to the fine balance of forces between the two halves of the sarcomere. The size and extensibility of the cross-links are the main determinants of sarcomere extensibility properties of muscle. In non-muscle cells, seems to play a role in chromosome condensation and chromosome segregation during mitosis. Might link the lamina network to chromatin or nuclear actin, or both during interphase.
Structural component of the muscle M line which is involved in assembly and organization of sarcomere (PubMed:22467859, PubMed:26251439). Required for the development and organization of indirect flight muscle sarcomeres by regulating the formation of M line and H zone and the correct assembly of thick and thin filaments in the sarcomere (PubMed:22467859, PubMed:26251439). Likely to have serine/threonine-protein kinase activity as one of the two protein kinase domains appears to be functional (Probable).
Calcium/calmodulin-dependent myosin light chain kinase implicated in smooth muscle contraction via phosphorylation of myosin light chains (MLC). Also regulates actin-myosin interaction through a non-kinase activity. Phosphorylates PTK2B/PYK2 and myosin light-chains. Involved in the inflammatory response (e.g. apoptosis, vascular permeability, leukocyte diapedesis), cell motility and morphology, airway hyperreactivity and other activities relevant to asthma. Required for tonic airway smooth muscle contraction that is necessary for physiological and asthmatic airway resistance. Necessary for gastrointestinal motility. Implicated in the regulation of endothelial as well as vascular permeability, probably via the regulation of cytoskeletal rearrangements. In the nervous system it has been shown to control the growth initiation of astrocytic processes in culture and to participate in transmitter release at synapses formed between cultured sympathetic ganglion cells. Critical participant in signaling sequences that result in fibroblast apoptosis. Plays a role in the regulation of epithelial cell survival. Required for epithelial wound healing, especially during actomyosin ring contraction during purse-string wound closure. Mediates RhoA-dependent membrane blebbing. Triggers TRPC5 channel activity in a calcium-dependent signaling, by inducing its subcellular localization at the plasma membrane. Promotes cell migration (including tumor cells) and tumor metastasis. PTK2B/PYK2 activation by phosphorylation mediates ITGB2 activation and is thus essential to trigger neutrophil transmigration during acute lung injury (ALI). May regulate optic nerve head astrocyte migration. Probably involved in mitotic cytoskeletal regulation. Regulates tight junction probably by modulating ZO-1 exchange in the perijunctional actomyosin ring. Mediates burn-induced microvascular barrier injury; triggers endothelial contraction in the development of microvascular hyperpermeability by phosphorylating MLC. Essential for intestinal barrier dysfunction. Mediates Giardia spp.-mediated reduced epithelial barrier function during giardiasis intestinal infection via reorganization of cytoskeletal F-actin and tight junctional ZO-1. Necessary for hypotonicity-induced Ca(2+) entry and subsequent activation of volume-sensitive organic osmolyte/anion channels (VSOAC) in cervical cancer cells. Responsible for high proliferative ability of breast cancer cells through anti-apoptosis.
Calcium/calmodulin-dependent myosin light chain kinase implicated in smooth muscle contraction via phosphorylation of myosin light chains (MLC). Also regulates actin-myosin interaction through a non-kinase activity. Phosphorylates PTK2B/PYK2 and myosin light-chains. Involved in the inflammatory response (e.g. apoptosis, vascular permeability, leukocyte diapedesis), cell motility and morphology, airway hyperreactivity and other activities relevant to asthma. Required for tonic airway smooth muscle contraction that is necessary for physiological and asthmatic airway resistance. Necessary for gastrointestinal motility. Implicated in the regulation of endothelial as well as vascular permeability, probably via the regulation of cytoskeletal rearrangements. In the nervous system it has been shown to control the growth initiation of astrocytic processes in culture and to participate in transmitter release at synapses formed between cultured sympathetic ganglion cells. Critical participant in signaling sequences that result in fibroblast apoptosis. Plays a role in the regulation of epithelial cell survival. Required for epithelial wound healing, especially during actomyosin ring contraction during purse-string wound closure. Mediates RhoA-dependent membrane blebbing. Triggers TRPC5 channel activity in a calcium-dependent signaling, by inducing its subcellular localization at the plasma membrane. Promotes cell migration (including tumor cells) and tumor metastasis. PTK2B/PYK2 activation by phosphorylation mediates ITGB2 activation and is thus essential to trigger neutrophil transmigration during acute lung injury (ALI). May regulate optic nerve head astrocyte migration. Probably involved in mitotic cytoskeletal regulation. Regulates tight junction probably by modulating ZO-1 exchange in the perijunctional actomyosin ring. Mediates burn-induced microvascular barrier injury; triggers endothelial contraction in the development of microvascular hyperpermeability by phosphorylating MLC. Essential for intestinal barrier dysfunction. Mediates Giardia spp.-mediated reduced epithelial barrier function during giardiasis intestinal infection via reorganization of cytoskeletal F-actin and tight junctional ZO-1. Necessary for hypotonicity-induced Ca(2+) entry and subsequent activation of volume-sensitive organic osmolyte/anion channels (VSOAC) in cervical cancer cells.
Promotes cleavage furrow maturation during cytokinesis in preimplantation embryos (PubMed:21215633). May play a role in the architecture of adhesive and flexible epithelial cell junctions (PubMed:17015624). May play a role during myocardial remodeling by imparting an effect on cardiac fibroblast migration (PubMed:24951538).
Promotes cleavage furrow maturation during cytokinesis in preimplantation embryos. May play a role in the architecture of adhesive and flexible epithelial cell junctions. May play a role during myocardial remodeling by imparting an effect on cardiac fibroblast migration.
Thought to be involved during neural development in axonal navigation at the ventral midline of the neural tube. In spinal chord development plays a role in guiding commissural axons probably by preventing premature sensitivity to Slit proteins thus inhibiting Slit signaling through ROBO1 (By similarity). Required for hindbrain axon midline crossing.
Cytoskeletal protein required for organization of normal actin cytoskeleton. Roles in establishing cell morphology, motility, cell adhesion and cell-extracellular matrix interactions in a variety of cell types. May function as a scaffolding molecule with the potential to influence both actin polymerization and the assembly of existing actin filaments into higher-order arrays. Binds to proteins that bind to either monomeric or filamentous actin. Localizes at sites where active actin remodeling takes place, such as lamellipodia and membrane ruffles. Different isoforms may have functional differences. Plays a role in neurite outgrowth and in the establishment of polarity during neuronal morphogenesis. Participates in the acquisition of the reactive astrocyte morphology.
In conjunction with another transmembrane protein, CNTNAP2, contributes to the organization of axonal domains at nodes of Ranvier by maintaining voltage-gated potassium channels at the juxtaparanodal region.
Displays low peroxidase activity and is likely to participate in H(2)O(2) metabolism and peroxidative reactions in the cardiovascular system (By similarity). Plays a role in extracellular matrix formation.
Receptor for SLIT2, and probably SLIT1, which are thought to act as molecular guidance cue in cellular migration, including axonal navigation at the ventral midline of the neural tube and projection of axons to different regions during neuronal development.
Structural component of striated muscles which plays a role in myofibrillogenesis. Probably involved in the assembly of myosin into sarcomeric A bands in striated muscle (By similarity). Has serine/threonine protein kinase activity and phosphorylates N-cadherin CDH2 and sodium/potassium-transporting ATPase subunit ATP1B1 (PubMed:23392350). Binds (via the PH domain) strongly to phosphatidylinositol 3,4-bisphosphate (PtdIns(3,4)P2) and phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2), and to a lesser extent to phosphatidylinositol 3-phosphate (PtdIns(3)P), phosphatidylinositol 4-phosphate (PtdIns(4)P), phosphatidylinositol 5-phosphate (PtdIns(5)P) and phosphatidylinositol 3,4,5-trisphosphate (PtdIns(3,4,5)P3) (By similarity).
Isoform 2 and isoform 3: bind phosphatidylinositol bisphosphates (PIP2s) via their PH domains and negatively regulate the PI3K/AKT/mTOR signaling pathway, thus contributing to the regulation of cardiomyocyte size and adhesion.
Core component of the 3M complex, a complex required to regulate microtubule dynamics and genome integrity. It is unclear how the 3M complex regulates microtubules, it could act by controlling the level of a microtubule stabilizer. Acts as a regulator of the Cul7-RING(FBXW8) ubiquitin-protein ligase, playing a critical role in the ubiquitin ligase pathway that regulates Golgi morphogenesis and dendrite patterning in brain. Required to localize CUL7 to the Golgi apparatus in neurons (By similarity).
Core component of the 3M complex, a complex required to regulate microtubule dynamics and genome integrity. It is unclear how the 3M complex regulates microtubules, it could act by controlling the level of a microtubule stabilizer (By similarity). Acts as a regulator of the Cul7-RING(FBXW8) ubiquitin-protein ligase, playing a critical role in the ubiquitin ligase pathway that regulates Golgi morphogenesis and dendrite patterning in brain. Required to localize CUL7 to the Golgi apparatus in neurons.
Core component of the 3M complex, a complex required to regulate microtubule dynamics and genome integrity. It is unclear how the 3M complex regulates microtubules, it could act by controlling the level of a microtubule stabilizer (PubMed:24793695, PubMed:24793696). Acts as a regulator of the Cul7-RING(FBXW8) ubiquitin-protein ligase, playing a critical role in the ubiquitin ligase pathway that regulates Golgi morphogenesis and dendrite patterning in brain. Required to localize CUL7 to the Golgi apparatus in neurons.
Structural component of striated muscles which plays a role in myofibrillogenesis. Probably involved in the assembly of myosin into sarcomeric A bands in striated muscle (PubMed:11448995, PubMed:16205939). Has serine/threonine protein kinase activity and phosphorylates N-cadherin CDH2 and sodium/potassium-transporting ATPase subunit ATP1B1 (By similarity). Binds (via the PH domain) strongly to phosphatidylinositol 3,4-bisphosphate (PtdIns(3,4)P2) and phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2), and to a lesser extent to phosphatidylinositol 3-phosphate (PtdIns(3)P), phosphatidylinositol 4-phosphate (PtdIns(4)P), phosphatidylinositol 5-phosphate (PtdIns(5)P) and phosphatidylinositol 3,4,5-trisphosphate (PtdIns(3,4,5)P3) (PubMed:28826662).
Catalytic Activity
ATP + L-seryl-[protein] = ADP + H(+) + O-phospho-L-seryl-[protein]
ATP + L-threonyl-[protein] = ADP + H(+) + O-phospho-L-threonyl-[protein]
[myosin light chain]-L-serine + ATP = [myosin light chain]-O-phospho-L-serine + ADP + H(+)
[myosin light chain]-L-threonine + ATP = [myosin light chain]-O-phospho-L-threonine + ADP + H(+)
2 a phenolic donor + H2O2 = 2 a phenolic radical donor + 2 H2O
ATP + L-threonyl-[protein] = ADP + H(+) + O-phospho-L-threonyl-[protein]
[myosin light chain]-L-serine + ATP = [myosin light chain]-O-phospho-L-serine + ADP + H(+)
[myosin light chain]-L-threonine + ATP = [myosin light chain]-O-phospho-L-threonine + ADP + H(+)
2 a phenolic donor + H2O2 = 2 a phenolic radical donor + 2 H2O
Cofactor
Mg(2+)
Ca(2+)
heme b
Ca(2+)
heme b
Biophysicochemical Properties
6.5 uM for MLC (isoform 1 at 22 degrees Celsius)
7.2 uM for MLC (isoform 2 at 22 degrees Celsius)
7.2 uM for MLC (isoform 2 at 22 degrees Celsius)
Subunit
Interacts (via C-terminus) with myosin. Interacts with actin.
May interact (via fibronectin type-III domain 1, Ig-like C2-type domain 48/49 and protein kinase domain 1 or C-terminus of the interkinase region) with lim-9 (via LIM zinc-binding domain) (PubMed:19244614). May interact (via fibronectin type-III domain 1, Ig-like C2-type domain 48/49 and kinase protein domain 1 or Ig-like C2-type domain 50, fibronectin type-III domain 2 and kinase protein domain 2) with scpl-1 isoforms a and b (via FCP1 homology domain); the interaction may act as a molecular bridge to bring two unc-89 molecules together or to stabilize a loop between the 2 kinase domains (PubMed:18337465, PubMed:19244614). May interact (via SH3 domain) with unc-15 (PubMed:27009202). May interact (via Ig-like C2-type domain 1-3) with cpna-1 (via VWFA domain) (PubMed:23283987). May interact (via Ig-like C2-type domain 2/3 and, Ig-like C2-type domain 50 and fibronectin type-III domain 2) with mel-26 (via MATH domain) (PubMed:22621901). May interact (via DH and PH domains) with rho-1, ced-10, mig-2 and cdc-42 (PubMed:18801371).
Interacts with MYOM1, MYOM2, tropomyosin and myosin. Interacts with actin, primarily via the PEVK domains and with MYPN. Interacts with FHL2, NEB, CRYAB, LMNA/lamin-A and LMNB/lamin-B. Interacts with TCAP/telethonin and/or ANK1 isoform Mu17/ank1.5, via the first two N-terminal immunoglobulin domains. Interacts with TRIM63, TRIM55, ANKRD1, ANKRD2, ANKRD23, and CAPN3 through several Ig domains. Interacts with NBR1 through the protein kinase domain (By similarity). Interacts with CMYA5 (By similarity).
Interacts with MYOM1, MYOM2, tropomyosin and myosin. Interacts with actin, primarily via the PEVK domains and with MYPN (By similarity). Interacts with FHL2, NEB, CRYAB, LMNA/lamin-A and LMNB/lamin-B. Interacts with TCAP/telethonin and/or ANK1 isoform Mu17/ank1.5, via the first two N-terminal immunoglobulin domains. Interacts with TRIM63 and TRIM55, through several domains including immunoglobulin domains 141 and 142. Interacts with ANKRD1, ANKRD2 and ANKRD23, via the region between immunoglobulin domains 77 and 78 and interacts with CAPN3, via immunoglobulin domain 79. Interacts with NBR1 through the protein kinase domain. Interacts with CALM/calmodulin. Isoform 6 interacts with OBSCN isoform 3. Interacts with CMYA5.
Interacts with myosin (PubMed:22467859). May interact (via protein kinase domain 1) with ball (PubMed:26251439). May interact (via protein kinase domain 1 or 2) with mask (PubMed:26251439). May interact (via protein kinase domain 2) with Tm1/tropomyosin-1 (PubMed:26251439).
All isoforms including Telokin bind calmodulin. Interacts with SVIL (By similarity). Interacts with CTTN; this interaction is reduced during thrombin-induced endothelial cell (EC) contraction but is promoted by the barrier-protective agonist sphingosine 1-phosphate (S1P) within lamellipodia. A complex made of ABL1, CTTN and MYLK regulates cortical actin-based cytoskeletal rearrangement critical to sphingosine 1-phosphate (S1P)-mediated endothelial cell (EC) barrier enhancement. Binds to NAA10/ARD1 and PTK2B/PYK2.
All isoforms including Telokin bind calmodulin. Interacts with CTTN; this interaction is reduced during thrombin-induced endothelial cell (EC) contraction but is promoted by the barrier-protective agonist sphingosine 1-phosphate (S1P) within lamellipodia. A complex made of ABL1, CTTN and MYLK regulates cortical actin-based cytoskeletal rearrangement critical to sphingosine 1-phosphate (S1P)-mediated endothelial cell (EC) barrier enhancement. Binds to NAA10/ARD1 (By similarity). Interacts with SVIL and PTK2B/PYK2.
All isoforms including Telokin bind calmodulin.
Interacts with MTM1. Isoform 3 is found as a monomer or homodimer.
Interacts with MTM1 (By similarity).
Interacts with MTM1 (By similarity). Isoform 3 is found as a monomer or homodimer.
Probably interacts with SLIT2.
Interacts with EPS8 (By similarity). Interacts with LASP1 (By similarity). Interacts with VASP (By similarity). Interacts with ACTN (By similarity). Interacts with ARGBP2 (By similarity). Interacts with PFN1 (By similarity). Interacts with LPP (By similarity). Interacts with SPIN90 (By similarity). Interacts with SRC (By similarity). Interacts with EZR (By similarity). Interacts with RAI14 (PubMed:23565266).
Interacts with SLIT2.
Interacts (via protein kinase domain 1) with CDH2 and (via protein kinase domain 1) with ATP1B1 (PubMed:23392350). Isoform 2 is found in a complex with DSG2, DESM, GJA1, CDH2 and VCL (PubMed:28826662). Isoform 3 is found in a complex with DSG2, DESM, GJA1, CDH2, ANK3 and VCL (PubMed:28826662).
Component of the 3M complex, composed of core components CUL7, CCDC8 and OBSL1. Interacts with CCDC8. Interacts with CUL7; the interaction is direct. Interacts with FBXW8. Interacts (via N-terminal Ig-like domain) with TTN/titin (via C-terminal Ig-like domain); the interaction is direct (By similarity).
Component of the 3M complex, composed of core components CUL7, CCDC8 and OBSL1. Interacts with CCDC8. Interacts with CUL7; the interaction is direct. Interacts with FBXW8. Interacts (via N-terminal Ig-like domain) with TTN/titin (via C-terminal Ig-like domain); the interaction is direct.
Interacts (via protein kinase domain 2) with CDH2 and (via protein kinase domain 1) with ATP1B1 (By similarity). Isoform 3 interacts with TTN/titin and calmodulin (PubMed:11448995, PubMed:11717165). Isoform 3 interacts with ANK1 isoform Mu17/ank1.5 (PubMed:12527750).
May interact (via fibronectin type-III domain 1, Ig-like C2-type domain 48/49 and protein kinase domain 1 or C-terminus of the interkinase region) with lim-9 (via LIM zinc-binding domain) (PubMed:19244614). May interact (via fibronectin type-III domain 1, Ig-like C2-type domain 48/49 and kinase protein domain 1 or Ig-like C2-type domain 50, fibronectin type-III domain 2 and kinase protein domain 2) with scpl-1 isoforms a and b (via FCP1 homology domain); the interaction may act as a molecular bridge to bring two unc-89 molecules together or to stabilize a loop between the 2 kinase domains (PubMed:18337465, PubMed:19244614). May interact (via SH3 domain) with unc-15 (PubMed:27009202). May interact (via Ig-like C2-type domain 1-3) with cpna-1 (via VWFA domain) (PubMed:23283987). May interact (via Ig-like C2-type domain 2/3 and, Ig-like C2-type domain 50 and fibronectin type-III domain 2) with mel-26 (via MATH domain) (PubMed:22621901). May interact (via DH and PH domains) with rho-1, ced-10, mig-2 and cdc-42 (PubMed:18801371).
Interacts with MYOM1, MYOM2, tropomyosin and myosin. Interacts with actin, primarily via the PEVK domains and with MYPN. Interacts with FHL2, NEB, CRYAB, LMNA/lamin-A and LMNB/lamin-B. Interacts with TCAP/telethonin and/or ANK1 isoform Mu17/ank1.5, via the first two N-terminal immunoglobulin domains. Interacts with TRIM63, TRIM55, ANKRD1, ANKRD2, ANKRD23, and CAPN3 through several Ig domains. Interacts with NBR1 through the protein kinase domain (By similarity). Interacts with CMYA5 (By similarity).
Interacts with MYOM1, MYOM2, tropomyosin and myosin. Interacts with actin, primarily via the PEVK domains and with MYPN (By similarity). Interacts with FHL2, NEB, CRYAB, LMNA/lamin-A and LMNB/lamin-B. Interacts with TCAP/telethonin and/or ANK1 isoform Mu17/ank1.5, via the first two N-terminal immunoglobulin domains. Interacts with TRIM63 and TRIM55, through several domains including immunoglobulin domains 141 and 142. Interacts with ANKRD1, ANKRD2 and ANKRD23, via the region between immunoglobulin domains 77 and 78 and interacts with CAPN3, via immunoglobulin domain 79. Interacts with NBR1 through the protein kinase domain. Interacts with CALM/calmodulin. Isoform 6 interacts with OBSCN isoform 3. Interacts with CMYA5.
Interacts with myosin (PubMed:22467859). May interact (via protein kinase domain 1) with ball (PubMed:26251439). May interact (via protein kinase domain 1 or 2) with mask (PubMed:26251439). May interact (via protein kinase domain 2) with Tm1/tropomyosin-1 (PubMed:26251439).
All isoforms including Telokin bind calmodulin. Interacts with SVIL (By similarity). Interacts with CTTN; this interaction is reduced during thrombin-induced endothelial cell (EC) contraction but is promoted by the barrier-protective agonist sphingosine 1-phosphate (S1P) within lamellipodia. A complex made of ABL1, CTTN and MYLK regulates cortical actin-based cytoskeletal rearrangement critical to sphingosine 1-phosphate (S1P)-mediated endothelial cell (EC) barrier enhancement. Binds to NAA10/ARD1 and PTK2B/PYK2.
All isoforms including Telokin bind calmodulin. Interacts with CTTN; this interaction is reduced during thrombin-induced endothelial cell (EC) contraction but is promoted by the barrier-protective agonist sphingosine 1-phosphate (S1P) within lamellipodia. A complex made of ABL1, CTTN and MYLK regulates cortical actin-based cytoskeletal rearrangement critical to sphingosine 1-phosphate (S1P)-mediated endothelial cell (EC) barrier enhancement. Binds to NAA10/ARD1 (By similarity). Interacts with SVIL and PTK2B/PYK2.
All isoforms including Telokin bind calmodulin.
Interacts with MTM1. Isoform 3 is found as a monomer or homodimer.
Interacts with MTM1 (By similarity).
Interacts with MTM1 (By similarity). Isoform 3 is found as a monomer or homodimer.
Probably interacts with SLIT2.
Interacts with EPS8 (By similarity). Interacts with LASP1 (By similarity). Interacts with VASP (By similarity). Interacts with ACTN (By similarity). Interacts with ARGBP2 (By similarity). Interacts with PFN1 (By similarity). Interacts with LPP (By similarity). Interacts with SPIN90 (By similarity). Interacts with SRC (By similarity). Interacts with EZR (By similarity). Interacts with RAI14 (PubMed:23565266).
Interacts with SLIT2.
Interacts (via protein kinase domain 1) with CDH2 and (via protein kinase domain 1) with ATP1B1 (PubMed:23392350). Isoform 2 is found in a complex with DSG2, DESM, GJA1, CDH2 and VCL (PubMed:28826662). Isoform 3 is found in a complex with DSG2, DESM, GJA1, CDH2, ANK3 and VCL (PubMed:28826662).
Component of the 3M complex, composed of core components CUL7, CCDC8 and OBSL1. Interacts with CCDC8. Interacts with CUL7; the interaction is direct. Interacts with FBXW8. Interacts (via N-terminal Ig-like domain) with TTN/titin (via C-terminal Ig-like domain); the interaction is direct (By similarity).
Component of the 3M complex, composed of core components CUL7, CCDC8 and OBSL1. Interacts with CCDC8. Interacts with CUL7; the interaction is direct. Interacts with FBXW8. Interacts (via N-terminal Ig-like domain) with TTN/titin (via C-terminal Ig-like domain); the interaction is direct.
Interacts (via protein kinase domain 2) with CDH2 and (via protein kinase domain 1) with ATP1B1 (By similarity). Isoform 3 interacts with TTN/titin and calmodulin (PubMed:11448995, PubMed:11717165). Isoform 3 interacts with ANK1 isoform Mu17/ank1.5 (PubMed:12527750).
Miscellaneous
In some isoforms, after the PEVK repeat region there is a long PEVK duplicated region. On account of this region, it has been very difficult to sequence the whole protein. The length of this region (ranging from 183 to 2174 residues), may be a key elastic element of titin.
In asthmatic patients, overexpression promotes actin filament propulsion, thus contributing to airway hyperresponsiveness. Some MYLK variants may contribute to acute lung injury (ALI) susceptibility. Potential therapeutic target in the treatment of burn edema.
Expression is under the tight control of the locus control region (LCRs).
In asthmatic patients, overexpression promotes actin filament propulsion, thus contributing to airway hyperresponsiveness. Some MYLK variants may contribute to acute lung injury (ALI) susceptibility. Potential therapeutic target in the treatment of burn edema.
Expression is under the tight control of the locus control region (LCRs).
Similarity
Belongs to the protein kinase superfamily. CAMK Ser/Thr protein kinase family.
Belongs to the immunoglobulin superfamily. ROBO family.
Belongs to the myotilin/palladin family.
Belongs to the immunoglobulin superfamily. Contactin family.
Belongs to the peroxidase family. XPO subfamily.
Belongs to the immunoglobulin superfamily. ROBO family.
Belongs to the myotilin/palladin family.
Belongs to the immunoglobulin superfamily. Contactin family.
Belongs to the peroxidase family. XPO subfamily.
Keywords
Alternative promoter usage
Alternative splicing
ATP-binding
Coiled coil
Complete proteome
Cytoplasm
Disulfide bond
Immunoglobulin domain
Kinase
Magnesium
Membrane
Metal-binding
Nucleotide-binding
Nucleus
Reference proteome
Repeat
Transferase
3D-structure
Muscle protein
SH3 domain
Cell cycle
Cell division
Chromosome
Developmental protein
Mitosis
TPR repeat
Calcium
Calmodulin-binding
Direct protein sequencing
Kelch repeat
Methylation
Phosphoprotein
WD repeat
Cardiomyopathy
Disease mutation
Limb-girdle muscular dystrophy
Polymorphism
EGF-like domain
Extracellular matrix
Glycoprotein
Secreted
Sensory transduction
Signal
Acetylation
Actin-binding
Aortic aneurysm
Cell projection
Cytoskeleton
Basement membrane
Cell junction
Age-related macular degeneration
Vision
Differentiation
Chemotaxis
Neurogenesis
Receptor
Transmembrane
Transmembrane helix
Cell adhesion
Cell membrane
GPI-anchor
Lipoprotein
Heme
Hydrogen peroxide
Iron
Leucine-rich repeat
Oxidoreductase
Peroxidase
Lipid-binding
Chromosomal rearrangement
Golgi apparatus
Dwarfism
Feature
chain Titin homolog
splice variant In isoform h and isoform i.
sequence variant In CMD1G; affects interaction with TCAP/telethonin; dbSNP:rs139517732.
propeptide Removed in mature form
splice variant In isoform h and isoform i.
sequence variant In CMD1G; affects interaction with TCAP/telethonin; dbSNP:rs139517732.
propeptide Removed in mature form
Uniprot
EC Number
2.7.11.1
2.7.11.18
1.11.1.7
2.7.11.18
1.11.1.7
Pubmed
12381307
9851916
16410549
18390597
20346955
8603916
+ More
15313609 16453163 17326220 18801371 18337465 19244614 21868609 22621901 22768340 23283987 27009202 11080629 10629221 10934048 10731132 12537572 9548712 10669599 9917396 8335002 11062264 12537569 22467859 26251439 19468303 9440711 16702235 17261657 17242355 21183079 24129315 7569978 10850961 11717165 15815621 15489334 8937992 7819249 10051295 12785098 8351016 1582406 8404852 17974005 9645487 12482578 12432079 12444090 14583192 14676215 15967462 16537787 20634290 7613868 9804419 9782056 11525170 16407954 10462489 12145747 11846417 11788824 12891679 16465475 15802564 17444505 17344846 23033978 25173926 16141072 17015624 21215633 15185077 18515368 8575746 9160829 10198165 11113114 10536370 15507455 15020676 14702039 16641997 12408982 11976941 14741352 15825080 16835238 16723733 16284075 18710790 18088087 18587400 18318008 19413330 19429448 19826488 20453870 20375339 20053363 20861316 20181817 20139351 21918590 19011151 22015949 22814378 24275569 18462678 21055718 11029314 11121372 11832329 11472067 8764148 12360480 16055522 16184195 17925381 17577141 18586037 21074048 20018858 20404178 15164053 24951538 16710414 14570714 7589469 2315320 9706877 2202734 3030394 1444462 1373815 9283094 12176732 10194305 10529260 8663449 16545539 10718198 23186163 16354304 25087613 15057822 22673903 10973969 12693553 16452087 19118250 15105459 19690332 10931874 11438925 11553711 12932445 16125169 16868024 22659164 23565266 18929642 19590037 18848646 21907015 14621295 15091338 15289607 23392350 28826662 16829019 10997877 9458045 10102268 11404413 17357069 21572988 17289344 9734811 12168954 18669648 19481195 21737058 24793695 24793696 23018678 20489725 20133654 11448995 16625316 11814696 12527750 12618763 16205939 16959974
15313609 16453163 17326220 18801371 18337465 19244614 21868609 22621901 22768340 23283987 27009202 11080629 10629221 10934048 10731132 12537572 9548712 10669599 9917396 8335002 11062264 12537569 22467859 26251439 19468303 9440711 16702235 17261657 17242355 21183079 24129315 7569978 10850961 11717165 15815621 15489334 8937992 7819249 10051295 12785098 8351016 1582406 8404852 17974005 9645487 12482578 12432079 12444090 14583192 14676215 15967462 16537787 20634290 7613868 9804419 9782056 11525170 16407954 10462489 12145747 11846417 11788824 12891679 16465475 15802564 17444505 17344846 23033978 25173926 16141072 17015624 21215633 15185077 18515368 8575746 9160829 10198165 11113114 10536370 15507455 15020676 14702039 16641997 12408982 11976941 14741352 15825080 16835238 16723733 16284075 18710790 18088087 18587400 18318008 19413330 19429448 19826488 20453870 20375339 20053363 20861316 20181817 20139351 21918590 19011151 22015949 22814378 24275569 18462678 21055718 11029314 11121372 11832329 11472067 8764148 12360480 16055522 16184195 17925381 17577141 18586037 21074048 20018858 20404178 15164053 24951538 16710414 14570714 7589469 2315320 9706877 2202734 3030394 1444462 1373815 9283094 12176732 10194305 10529260 8663449 16545539 10718198 23186163 16354304 25087613 15057822 22673903 10973969 12693553 16452087 19118250 15105459 19690332 10931874 11438925 11553711 12932445 16125169 16868024 22659164 23565266 18929642 19590037 18848646 21907015 14621295 15091338 15289607 23392350 28826662 16829019 10997877 9458045 10102268 11404413 17357069 21572988 17289344 9734811 12168954 18669648 19481195 21737058 24793695 24793696 23018678 20489725 20133654 11448995 16625316 11814696 12527750 12618763 16205939 16959974
EMBL
AY130758
BX284605
AAN61517.1
AAN61520.1
AAN61521.1
U33058
+ More
FO080458 AY724774 AY714779 AB026845 AJ238575 AJ238577 AJ271740 AJ400900 AJ400901 AJ400902 AE014296 AF045775 AF045776 AF045777 AF045778 AJ245406 AJ012279 AJ012280 AF135062 AF135167 AF241648 AF241649 BK000146 AY094749 AAC23966.1 AAF47604.1 AAG40155.1 AAM11102.1 BAA90301.2 CAA09971.1 CAB76253.1 CAB93524.1 CAB96426.1 DAA00021.1 AL928681 AL928721 AL928789 CAM23449.1 CAM27059.1 X90568 X90569 AJ277892 AC009948 AC010680 FJ695199 AC023270 BC013396 BC058824 BC070170 BC107797 X98114 X98115 X83270 AF058332 AF525413 DQ248309 X64698 X64699 X64697 X69490 AL713647 AK083701 AL732564 AL732572 AL928861 AE013599 DQ431841 ABD83643.1 X85337 U48959 AF069601 AF069602 AF069603 AF069604 AF096771 AF096766 AF096767 AF096768 AF096769 AF096770 AF096773 AF096774 AF096775 AY424269 AY424270 AY339601 AB037663 AK300610 AK314412 AK314443 AC020634 AC023165 CH471052 BC100761 BC100762 BC100763 BC064420 X90870 AY237727 AF314149 AY237726 AK162008 BC034209 BC045197 BC058610 AF335470 AAG34169.1 AAH34209.1 AAH45197.1 AAH58610.2 AAK53241.1 AAO85807.1 BAE36678.1 ABBA01012042 ABBA01043973 AL354898 AL360004 AUXG01000072 FP565345 KF458942 CH471090 AK074396 AK093583 AL834139 AC111145 AC113326 AC115051 AC124120 AF156100 AK056336 AK056557 AL118512 AL121996 AL133515 AL133553 AL135796 AL135797 AL391824 BX928748 AJ306906 X52876 M31048 M14953 AF045285 AF045255 AF045256 AF045257 AF045260 AF045259 AF045258 AF045261 AF045263 AF045265 AF045274 AF045273 AF045272 AF045271 AF045270 AF045269 AF045268 AF045267 AF045266 AF045283 AF045282 AF045281 AF045280 AF045279 AF045278 AF045277 AF045276 AF045275 AF045284 AF045264 AF045262 M96655 M88283 M88284 U57099 AK126500 AK289531 CR542201 AC053503 CH471063 BC006346 DQ395348 AY603755 AB037718 AABR03067996 U57097 U57098 AF215896 AK035543 AK164360 BC048698 BC062643 AK122488 AY509035 AK056544 AC080188 AC084353 AC115538 BC066106 BC053033 X81365 AK142872 AC159626 AC165078 BC112913 BC055333 AK129396 GL456158 BC044882 BC060226 AY603754 AAT80900.1 DQ533874 AB046788 DQ533873 AC016942 AC016952 AC024256 AC026877 AC067717 AC117514 AC117515 AC117516 AC126467 AC130004 AC131005 AC131154 AC133040 AC138974 BC064374 BC146772 AF040991 AC115011 BC051643 AC112361 EF063637 EF063638 AC009955 BC007201 AB014557 AJ002535 AJ314896 AJ314898 AJ314900 AJ314901 AJ314903 AJ314904 AJ314905 AJ314906 AJ314907 AJ314908 AL353593 AL359510 AL670729 AM231061 AB046776 AB046859
FO080458 AY724774 AY714779 AB026845 AJ238575 AJ238577 AJ271740 AJ400900 AJ400901 AJ400902 AE014296 AF045775 AF045776 AF045777 AF045778 AJ245406 AJ012279 AJ012280 AF135062 AF135167 AF241648 AF241649 BK000146 AY094749 AAC23966.1 AAF47604.1 AAG40155.1 AAM11102.1 BAA90301.2 CAA09971.1 CAB76253.1 CAB93524.1 CAB96426.1 DAA00021.1 AL928681 AL928721 AL928789 CAM23449.1 CAM27059.1 X90568 X90569 AJ277892 AC009948 AC010680 FJ695199 AC023270 BC013396 BC058824 BC070170 BC107797 X98114 X98115 X83270 AF058332 AF525413 DQ248309 X64698 X64699 X64697 X69490 AL713647 AK083701 AL732564 AL732572 AL928861 AE013599 DQ431841 ABD83643.1 X85337 U48959 AF069601 AF069602 AF069603 AF069604 AF096771 AF096766 AF096767 AF096768 AF096769 AF096770 AF096773 AF096774 AF096775 AY424269 AY424270 AY339601 AB037663 AK300610 AK314412 AK314443 AC020634 AC023165 CH471052 BC100761 BC100762 BC100763 BC064420 X90870 AY237727 AF314149 AY237726 AK162008 BC034209 BC045197 BC058610 AF335470 AAG34169.1 AAH34209.1 AAH45197.1 AAH58610.2 AAK53241.1 AAO85807.1 BAE36678.1 ABBA01012042 ABBA01043973 AL354898 AL360004 AUXG01000072 FP565345 KF458942 CH471090 AK074396 AK093583 AL834139 AC111145 AC113326 AC115051 AC124120 AF156100 AK056336 AK056557 AL118512 AL121996 AL133515 AL133553 AL135796 AL135797 AL391824 BX928748 AJ306906 X52876 M31048 M14953 AF045285 AF045255 AF045256 AF045257 AF045260 AF045259 AF045258 AF045261 AF045263 AF045265 AF045274 AF045273 AF045272 AF045271 AF045270 AF045269 AF045268 AF045267 AF045266 AF045283 AF045282 AF045281 AF045280 AF045279 AF045278 AF045277 AF045276 AF045275 AF045284 AF045264 AF045262 M96655 M88283 M88284 U57099 AK126500 AK289531 CR542201 AC053503 CH471063 BC006346 DQ395348 AY603755 AB037718 AABR03067996 U57097 U57098 AF215896 AK035543 AK164360 BC048698 BC062643 AK122488 AY509035 AK056544 AC080188 AC084353 AC115538 BC066106 BC053033 X81365 AK142872 AC159626 AC165078 BC112913 BC055333 AK129396 GL456158 BC044882 BC060226 AY603754 AAT80900.1 DQ533874 AB046788 DQ533873 AC016942 AC016952 AC024256 AC026877 AC067717 AC117514 AC117515 AC117516 AC126467 AC130004 AC131005 AC131154 AC133040 AC138974 BC064374 BC146772 AF040991 AC115011 BC051643 AC112361 EF063637 EF063638 AC009955 BC007201 AB014557 AJ002535 AJ314896 AJ314898 AJ314900 AJ314901 AJ314903 AJ314904 AJ314905 AJ314906 AJ314907 AJ314908 AL353593 AL359510 AL670729 AM231061 AB046776 AB046859
Proteomes
PRIDE
Pfam
Interpro
IPR011009
Kinase-like_dom_sf
+ More
IPR008271 Ser/Thr_kinase_AS
IPR036116 FN3_sf
IPR013098 Ig_I-set
IPR003961 FN3_dom
IPR003599 Ig_sub
IPR007110 Ig-like_dom
IPR017441 Protein_kinase_ATP_BS
IPR013783 Ig-like_fold
IPR003598 Ig_sub2
IPR036179 Ig-like_dom_sf
IPR000719 Prot_kinase_dom
IPR013106 Ig_V-set
IPR036028 SH3-like_dom_sf
IPR035899 DBL_dom_sf
IPR001849 PH_domain
IPR000219 DH-domain
IPR035526 Obscurin_SH3
IPR011993 PH-like_dom_sf
IPR001452 SH3_domain
IPR007850 RCSD
IPR010939 Titin-rpts
IPR015129 Titin_Z_rpt
IPR004168 PPAK_motif
IPR008266 Tyr_kinase_AS
IPR040849 MyBP-C_THB
IPR000152 EGF-type_Asp/Asn_hydroxyl_site
IPR000742 EGF-like_dom
IPR013032 EGF-like_CS
IPR018097 EGF_Ca-bd_CS
IPR026823 cEGF
IPR009030 Growth_fac_rcpt_cys_sf
IPR009017 GFP
IPR006605 G2_nidogen/fibulin_G2F
IPR036465 vWFA_dom_sf
IPR032984 Hemicentin-2
IPR001881 EGF-like_Ca-bd_dom
IPR015725 MLCK1_kinase_dom
IPR036383 TSP1_rpt_sf
IPR000884 TSP1_rpt
IPR015726 Ser/Thr_kin_striated-sp
IPR032987 Robo3
IPR033017 Palladin_C
IPR032991 Contactin-2
IPR003591 Leu-rich_rpt_typical-subtyp
IPR019791 Haem_peroxidase_animal
IPR001611 Leu-rich_rpt
IPR000483 Cys-rich_flank_reg_C
IPR037120 Haem_peroxidase_sf_animal
IPR001007 VWF_dom
IPR010255 Haem_peroxidase_sf
IPR034824 Peroxidasin_peroxidase
IPR032675 LRR_dom_sf
IPR034828 Peroxidasin
IPR000048 IQ_motif_EF-hand-BS
IPR008271 Ser/Thr_kinase_AS
IPR036116 FN3_sf
IPR013098 Ig_I-set
IPR003961 FN3_dom
IPR003599 Ig_sub
IPR007110 Ig-like_dom
IPR017441 Protein_kinase_ATP_BS
IPR013783 Ig-like_fold
IPR003598 Ig_sub2
IPR036179 Ig-like_dom_sf
IPR000719 Prot_kinase_dom
IPR013106 Ig_V-set
IPR036028 SH3-like_dom_sf
IPR035899 DBL_dom_sf
IPR001849 PH_domain
IPR000219 DH-domain
IPR035526 Obscurin_SH3
IPR011993 PH-like_dom_sf
IPR001452 SH3_domain
IPR007850 RCSD
IPR010939 Titin-rpts
IPR015129 Titin_Z_rpt
IPR004168 PPAK_motif
IPR008266 Tyr_kinase_AS
IPR040849 MyBP-C_THB
IPR000152 EGF-type_Asp/Asn_hydroxyl_site
IPR000742 EGF-like_dom
IPR013032 EGF-like_CS
IPR018097 EGF_Ca-bd_CS
IPR026823 cEGF
IPR009030 Growth_fac_rcpt_cys_sf
IPR009017 GFP
IPR006605 G2_nidogen/fibulin_G2F
IPR036465 vWFA_dom_sf
IPR032984 Hemicentin-2
IPR001881 EGF-like_Ca-bd_dom
IPR015725 MLCK1_kinase_dom
IPR036383 TSP1_rpt_sf
IPR000884 TSP1_rpt
IPR015726 Ser/Thr_kin_striated-sp
IPR032987 Robo3
IPR033017 Palladin_C
IPR032991 Contactin-2
IPR003591 Leu-rich_rpt_typical-subtyp
IPR019791 Haem_peroxidase_animal
IPR001611 Leu-rich_rpt
IPR000483 Cys-rich_flank_reg_C
IPR037120 Haem_peroxidase_sf_animal
IPR001007 VWF_dom
IPR010255 Haem_peroxidase_sf
IPR034824 Peroxidasin_peroxidase
IPR032675 LRR_dom_sf
IPR034828 Peroxidasin
IPR000048 IQ_motif_EF-hand-BS
SUPFAM
CDD
ProteinModelPortal
PDB
3B43
E-value=3.35704e-31,
Score=349
Ontologies
GO
GO:0031965
GO:0031430
GO:0030017
GO:0031674
GO:0017022
GO:0046872
GO:0051015
GO:0004674
GO:0031672
GO:0005524
GO:0045989
GO:0004672
GO:1905905
GO:0040017
GO:0045214
GO:0019902
GO:0017048
GO:0014722
GO:1905552
GO:0035023
GO:0030241
GO:0034613
GO:0031034
GO:0010628
GO:0090736
GO:0060298
GO:0005089
GO:0071688
GO:0007517
GO:0007520
GO:0007498
GO:0051301
GO:0000794
GO:0040011
GO:0007062
GO:0007522
GO:0030018
GO:0005863
GO:0035206
GO:0007525
GO:0007076
GO:0003779
GO:0016203
GO:0008307
GO:0007519
GO:0048739
GO:0007512
GO:0055003
GO:0048769
GO:0035995
GO:0005509
GO:0055002
GO:0042802
GO:0006936
GO:0050790
GO:0043056
GO:0030016
GO:0007507
GO:0019901
GO:0055008
GO:0060048
GO:0042805
GO:0045859
GO:0060419
GO:0010737
GO:0005865
GO:0019899
GO:0021591
GO:0051371
GO:0030240
GO:0043621
GO:0051592
GO:0002020
GO:0003007
GO:0030506
GO:1901897
GO:0031433
GO:0001701
GO:0005516
GO:0005859
GO:0003300
GO:0001756
GO:0004713
GO:0005200
GO:0050714
GO:0030049
GO:0070062
GO:0006941
GO:0097493
GO:0005576
GO:0002576
GO:0005829
GO:0032154
GO:0031012
GO:0005938
GO:0005604
GO:0005615
GO:0062023
GO:0050896
GO:0030054
GO:0036309
GO:0007527
GO:0016301
GO:0006468
GO:0007275
GO:0005523
GO:0030027
GO:0090303
GO:0060414
GO:0071476
GO:0032060
GO:0015629
GO:0005886
GO:0030335
GO:0072358
GO:0004687
GO:0051928
GO:0006939
GO:0001725
GO:0014820
GO:0005737
GO:0035865
GO:0005911
GO:0071277
GO:0035690
GO:0009617
GO:0007049
GO:0007157
GO:0038023
GO:0007156
GO:0042803
GO:0005913
GO:0050839
GO:0005201
GO:0007601
GO:0016020
GO:0005634
GO:0008285
GO:0042692
GO:0055013
GO:0060541
GO:0007411
GO:0098632
GO:0070593
GO:0071679
GO:0061642
GO:0030424
GO:0016199
GO:0016021
GO:0035385
GO:0002102
GO:0016477
GO:0060707
GO:0030175
GO:0071803
GO:0043025
GO:0001726
GO:0030036
GO:0031175
GO:0031529
GO:0005925
GO:0042060
GO:0044295
GO:0008092
GO:0071456
GO:0060168
GO:0048168
GO:0007628
GO:0031133
GO:0021853
GO:0022010
GO:0001764
GO:0044224
GO:0031623
GO:0045163
GO:0071205
GO:0043209
GO:0033268
GO:0010954
GO:0007612
GO:0097090
GO:0010769
GO:0043005
GO:0071206
GO:0009986
GO:0099025
GO:0000226
GO:0030246
GO:0007409
GO:0045202
GO:0007160
GO:0045665
GO:0048710
GO:0007413
GO:0030198
GO:0004601
GO:0042744
GO:0005783
GO:0020037
GO:0055114
GO:0006979
GO:0007420
GO:0003272
GO:0001656
GO:0035481
GO:0021891
GO:0031290
GO:0030673
GO:0050925
GO:0050772
GO:0003184
GO:0060412
GO:0003148
GO:0003180
GO:0001657
GO:0035904
GO:0008046
GO:1902936
GO:0030154
GO:0010314
GO:0042383
GO:0031432
GO:0014067
GO:0046777
GO:0032266
GO:0070273
GO:0016604
GO:0043325
GO:0014704
GO:0005546
GO:0045296
GO:0005547
GO:0007417
GO:0021510
GO:0032870
GO:0051964
GO:0061364
GO:0005794
GO:0007030
GO:0007088
GO:0050775
GO:0048471
GO:0005813
GO:1990393
GO:0034067
GO:0008093
GO:0007010
GO:0043687
GO:0007186
GO:0043065
GO:0051056
GO:0005515
GO:0008081
GO:0048013
GO:0005003
GO:0005887
GO:0007169
Topology
Subcellular location
Cytoplasm
Localizes throughout the I-band except for dense bodies and in the outer edge of the A-band (PubMed:20346955). In embryo, co-localizes with lamin lmn-1 at the nuclear membrane. The localization to the nuclear envelope is lmn-1-dependent(PubMed:16410549). With evidence from 8 publications.
Myofibril Localizes throughout the I-band except for dense bodies and in the outer edge of the A-band (PubMed:20346955). In embryo, co-localizes with lamin lmn-1 at the nuclear membrane. The localization to the nuclear envelope is lmn-1-dependent(PubMed:16410549). With evidence from 8 publications.
Sarcomere Localizes throughout the I-band except for dense bodies and in the outer edge of the A-band (PubMed:20346955). In embryo, co-localizes with lamin lmn-1 at the nuclear membrane. The localization to the nuclear envelope is lmn-1-dependent(PubMed:16410549). With evidence from 8 publications.
A band Localizes throughout the I-band except for dense bodies and in the outer edge of the A-band (PubMed:20346955). In embryo, co-localizes with lamin lmn-1 at the nuclear membrane. The localization to the nuclear envelope is lmn-1-dependent(PubMed:16410549). With evidence from 8 publications.
I band Localizes throughout the I-band except for dense bodies and in the outer edge of the A-band (PubMed:20346955). In embryo, co-localizes with lamin lmn-1 at the nuclear membrane. The localization to the nuclear envelope is lmn-1-dependent(PubMed:16410549). With evidence from 8 publications.
Nucleus membrane Localizes throughout the I-band except for dense bodies and in the outer edge of the A-band (PubMed:20346955). In embryo, co-localizes with lamin lmn-1 at the nuclear membrane. The localization to the nuclear envelope is lmn-1-dependent(PubMed:16410549). With evidence from 8 publications.
Colocalizes with scpl-1 (isoform b) to the M line (PubMed:19244614). Colocalizes with cpna-1 to the M line (PubMed:23283987). Colocalizes with mel-26 to the M line (PubMed:22621901). Accumulates at the center of thick myofilaments in M line-like structures in myoepithelial sheath cells (PubMed:17326220). With evidence from 11 publications.
Nucleus
Chromosome
Secreted The antibody used in PubMed:17015624 and PubMed:21215633 to determine subcellular location does not distinguish between HMCN1 and HMCN2. With evidence from 6 publications.
Extracellular space The antibody used in PubMed:17015624 and PubMed:21215633 to determine subcellular location does not distinguish between HMCN1 and HMCN2. With evidence from 6 publications.
Extracellular matrix The antibody used in PubMed:17015624 and PubMed:21215633 to determine subcellular location does not distinguish between HMCN1 and HMCN2. With evidence from 6 publications.
Cleavage furrow The antibody used in PubMed:17015624 and PubMed:21215633 to determine subcellular location does not distinguish between HMCN1 and HMCN2. With evidence from 6 publications.
Cell projection Localized to stress fibers during interphase and to the cleavage furrow during mitosis. With evidence from 20 publications.
Lamellipodium Localized to stress fibers during interphase and to the cleavage furrow during mitosis. With evidence from 20 publications.
Cytoskeleton Localized to stress fibers during interphase and to the cleavage furrow during mitosis. With evidence from 20 publications.
Stress fiber Localized to stress fibers during interphase and to the cleavage furrow during mitosis. With evidence from 20 publications.
Basement membrane The antibody used in PubMed:17015624 and PubMed:21215633 to determine subcellular location does not distinguish between HMCN1 and HMCN2. With evidence from 7 publications.
Cell junction The antibody used in PubMed:17015624 and PubMed:21215633 to determine subcellular location does not distinguish between HMCN1 and HMCN2. With evidence from 7 publications.
Cytosol
Membrane
Focal adhesion Localizes to stress fibers (PubMed:16868024, PubMed:11553711, PubMed:16125169, PubMed:22659164). Localizes to Z lines (PubMed:16868024, PubMed:11553711, PubMed:16125169). Preferentially expressed in the excitatory presynaptic terminals (PubMed:11438925). With evidence from 7 publications.
Z line Localizes to stress fibers (PubMed:16868024, PubMed:11553711, PubMed:16125169, PubMed:22659164). Localizes to Z lines (PubMed:16868024, PubMed:11553711, PubMed:16125169). Preferentially expressed in the excitatory presynaptic terminals (PubMed:11438925). With evidence from 7 publications.
Ruffle Localizes to stress fibers (PubMed:16868024, PubMed:11553711, PubMed:16125169, PubMed:22659164). Localizes to Z lines (PubMed:16868024, PubMed:11553711, PubMed:16125169). Preferentially expressed in the excitatory presynaptic terminals (PubMed:11438925). With evidence from 7 publications.
Podosome Localizes to stress fibers (PubMed:16868024, PubMed:11553711, PubMed:16125169, PubMed:22659164). Localizes to Z lines (PubMed:16868024, PubMed:11553711, PubMed:16125169). Preferentially expressed in the excitatory presynaptic terminals (PubMed:11438925). With evidence from 7 publications.
Axon Localizes to stress fibers (PubMed:16868024, PubMed:11553711, PubMed:16125169, PubMed:22659164). Localizes to Z lines (PubMed:16868024, PubMed:11553711, PubMed:16125169). Preferentially expressed in the excitatory presynaptic terminals (PubMed:11438925). With evidence from 7 publications.
Growth cone Localizes to stress fibers (PubMed:16868024, PubMed:11553711, PubMed:16125169, PubMed:22659164). Localizes to Z lines (PubMed:16868024, PubMed:11553711, PubMed:16125169). Preferentially expressed in the excitatory presynaptic terminals (PubMed:11438925). With evidence from 7 publications.
Cell membrane Attached to the neuronal membrane by a GPI-anchor and is also released from neurons. With evidence from 2 publications.
M line Colocalizes with CDH2 and ATP1B1 to the sarcolemma and to intercalating disks in cardiac muscles. Colocalizes with ATP1B1 to M line and Z line in cardiac muscles. One or both small isoforms, one probably containing protein kinase domain 2 and partial protein kinase domain 1 and one containing only protein kinase domain 2, localize to the extracellular side of the sarcolemma. With evidence from 14 publications.
Sarcolemma Colocalizes with CDH2 and ATP1B1 to the sarcolemma and to intercalating disks in cardiac muscles. Colocalizes with ATP1B1 to M line and Z line in cardiac muscles. One or both small isoforms, one probably containing protein kinase domain 2 and partial protein kinase domain 1 and one containing only protein kinase domain 2, localize to the extracellular side of the sarcolemma. With evidence from 14 publications.
Perinuclear region Colocalizes with CUL7 at the Golgi apparatus in neurons. With evidence from 2 publications.
Golgi apparatus Colocalizes with CUL7 at the Golgi apparatus in neurons. With evidence from 2 publications.
Microtubule organizing center
Centrosome
Myofibril Localizes throughout the I-band except for dense bodies and in the outer edge of the A-band (PubMed:20346955). In embryo, co-localizes with lamin lmn-1 at the nuclear membrane. The localization to the nuclear envelope is lmn-1-dependent(PubMed:16410549). With evidence from 8 publications.
Sarcomere Localizes throughout the I-band except for dense bodies and in the outer edge of the A-band (PubMed:20346955). In embryo, co-localizes with lamin lmn-1 at the nuclear membrane. The localization to the nuclear envelope is lmn-1-dependent(PubMed:16410549). With evidence from 8 publications.
A band Localizes throughout the I-band except for dense bodies and in the outer edge of the A-band (PubMed:20346955). In embryo, co-localizes with lamin lmn-1 at the nuclear membrane. The localization to the nuclear envelope is lmn-1-dependent(PubMed:16410549). With evidence from 8 publications.
I band Localizes throughout the I-band except for dense bodies and in the outer edge of the A-band (PubMed:20346955). In embryo, co-localizes with lamin lmn-1 at the nuclear membrane. The localization to the nuclear envelope is lmn-1-dependent(PubMed:16410549). With evidence from 8 publications.
Nucleus membrane Localizes throughout the I-band except for dense bodies and in the outer edge of the A-band (PubMed:20346955). In embryo, co-localizes with lamin lmn-1 at the nuclear membrane. The localization to the nuclear envelope is lmn-1-dependent(PubMed:16410549). With evidence from 8 publications.
Colocalizes with scpl-1 (isoform b) to the M line (PubMed:19244614). Colocalizes with cpna-1 to the M line (PubMed:23283987). Colocalizes with mel-26 to the M line (PubMed:22621901). Accumulates at the center of thick myofilaments in M line-like structures in myoepithelial sheath cells (PubMed:17326220). With evidence from 11 publications.
Nucleus
Chromosome
Secreted The antibody used in PubMed:17015624 and PubMed:21215633 to determine subcellular location does not distinguish between HMCN1 and HMCN2. With evidence from 6 publications.
Extracellular space The antibody used in PubMed:17015624 and PubMed:21215633 to determine subcellular location does not distinguish between HMCN1 and HMCN2. With evidence from 6 publications.
Extracellular matrix The antibody used in PubMed:17015624 and PubMed:21215633 to determine subcellular location does not distinguish between HMCN1 and HMCN2. With evidence from 6 publications.
Cleavage furrow The antibody used in PubMed:17015624 and PubMed:21215633 to determine subcellular location does not distinguish between HMCN1 and HMCN2. With evidence from 6 publications.
Cell projection Localized to stress fibers during interphase and to the cleavage furrow during mitosis. With evidence from 20 publications.
Lamellipodium Localized to stress fibers during interphase and to the cleavage furrow during mitosis. With evidence from 20 publications.
Cytoskeleton Localized to stress fibers during interphase and to the cleavage furrow during mitosis. With evidence from 20 publications.
Stress fiber Localized to stress fibers during interphase and to the cleavage furrow during mitosis. With evidence from 20 publications.
Basement membrane The antibody used in PubMed:17015624 and PubMed:21215633 to determine subcellular location does not distinguish between HMCN1 and HMCN2. With evidence from 7 publications.
Cell junction The antibody used in PubMed:17015624 and PubMed:21215633 to determine subcellular location does not distinguish between HMCN1 and HMCN2. With evidence from 7 publications.
Cytosol
Membrane
Focal adhesion Localizes to stress fibers (PubMed:16868024, PubMed:11553711, PubMed:16125169, PubMed:22659164). Localizes to Z lines (PubMed:16868024, PubMed:11553711, PubMed:16125169). Preferentially expressed in the excitatory presynaptic terminals (PubMed:11438925). With evidence from 7 publications.
Z line Localizes to stress fibers (PubMed:16868024, PubMed:11553711, PubMed:16125169, PubMed:22659164). Localizes to Z lines (PubMed:16868024, PubMed:11553711, PubMed:16125169). Preferentially expressed in the excitatory presynaptic terminals (PubMed:11438925). With evidence from 7 publications.
Ruffle Localizes to stress fibers (PubMed:16868024, PubMed:11553711, PubMed:16125169, PubMed:22659164). Localizes to Z lines (PubMed:16868024, PubMed:11553711, PubMed:16125169). Preferentially expressed in the excitatory presynaptic terminals (PubMed:11438925). With evidence from 7 publications.
Podosome Localizes to stress fibers (PubMed:16868024, PubMed:11553711, PubMed:16125169, PubMed:22659164). Localizes to Z lines (PubMed:16868024, PubMed:11553711, PubMed:16125169). Preferentially expressed in the excitatory presynaptic terminals (PubMed:11438925). With evidence from 7 publications.
Axon Localizes to stress fibers (PubMed:16868024, PubMed:11553711, PubMed:16125169, PubMed:22659164). Localizes to Z lines (PubMed:16868024, PubMed:11553711, PubMed:16125169). Preferentially expressed in the excitatory presynaptic terminals (PubMed:11438925). With evidence from 7 publications.
Growth cone Localizes to stress fibers (PubMed:16868024, PubMed:11553711, PubMed:16125169, PubMed:22659164). Localizes to Z lines (PubMed:16868024, PubMed:11553711, PubMed:16125169). Preferentially expressed in the excitatory presynaptic terminals (PubMed:11438925). With evidence from 7 publications.
Cell membrane Attached to the neuronal membrane by a GPI-anchor and is also released from neurons. With evidence from 2 publications.
M line Colocalizes with CDH2 and ATP1B1 to the sarcolemma and to intercalating disks in cardiac muscles. Colocalizes with ATP1B1 to M line and Z line in cardiac muscles. One or both small isoforms, one probably containing protein kinase domain 2 and partial protein kinase domain 1 and one containing only protein kinase domain 2, localize to the extracellular side of the sarcolemma. With evidence from 14 publications.
Sarcolemma Colocalizes with CDH2 and ATP1B1 to the sarcolemma and to intercalating disks in cardiac muscles. Colocalizes with ATP1B1 to M line and Z line in cardiac muscles. One or both small isoforms, one probably containing protein kinase domain 2 and partial protein kinase domain 1 and one containing only protein kinase domain 2, localize to the extracellular side of the sarcolemma. With evidence from 14 publications.
Perinuclear region Colocalizes with CUL7 at the Golgi apparatus in neurons. With evidence from 2 publications.
Golgi apparatus Colocalizes with CUL7 at the Golgi apparatus in neurons. With evidence from 2 publications.
Microtubule organizing center
Centrosome
Length:
8312
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00018
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1 - 8312
Population Genetic Test Statistics
Pi
23.677026
Theta
24.114091
Tajima's D
0.026657
CLR
0.106724
CSRT
0.373181340932953
Interpretation
Uncertain
