Gene

KWMTBOMO00039  Validated by peptides from experiments

Pre Gene Modal

BGIBMGA002087

Annotation

macrophage_migration_inhibitory_factor-like_protein_[Antheraea_yamamai]

Location

Bomo_Chr1(+):1268621-1271208      View in EpiBrowser

Full name

Macrophage migration inhibitory factor      

Alternative Name

L-dopachrome isomerase
L-dopachrome tautomerase
Phenylpyruvate tautomerase
Glycosylation-inhibiting factor

Location in the cell

Cytoplasmic   Reliability : 1.456 Mitochondrial   Reliability : 1.01

CDS

ATGACCTGGCGTTTCAAACAAGCAACATCAATCACATTGCAGTATCTACCTATAGTCGAACTCCGAGCGGTCTTGGAAGACATGCCGTGCCTTAAAATATTCACTAATTTGACAAACAGTTTCATACCCAATGATTTTGTTAATAAAATAATACCGGTCCTATCCAAGGCTGTGCAAAAATCACCTGAGAAATTTATATGCCTGATATCCCCCGACTGTGCCTTATCGATAGGAGGCGAGTCGTCCACACCAGGCGCTGTCGCCACCCTGGAATCGATTGGTAACCTGGGCCCAAGCCAAAATAAAGTCATCGCCAAAGAAATATCAGATTTCGTCGAAAAGGAATTGGGAATCTCGAAAGACAGATTTTTCTTAACATTCTACGATTTGAAGAACTTTAATGTAGCTAAAGGAGGAATCACCGTCGATGTATTGGAACCTTGA

Protein

MTWRFKQATSITLQYLPIVELRAVLEDMPCLKIFTNLTNSFIPNDFVNKIIPVLSKAVQKSPEKFICLISPDCALSIGGESSTPGAVATLESIGNLGPSQNKVIAKEISDFVEKELGISKDRFFLTFYDLKNFNVAKGGITVDVLEP

Description

Pro-inflammatory cytokine. Involved in the innate immune response to bacterial pathogens. The expression of MIF at sites of inflammation suggests a role as mediator in regulating the function of macrophages in host defense. Counteracts the anti-inflammatory activity of glucocorticoids. Has phenylpyruvate tautomerase and dopachrome tautomerase activity (in vitro), but the physiological substrate is not known. It is not clear whether the tautomerase activity has any physiological relevance, and whether it is important for cytokine activity (By similarity).
Pro-inflammatory cytokine. Involved in the innate immune response to bacterial pathogens. The expression of MIF at sites of inflammation suggests a role as mediator in regulating the function of macrophages in host defense. Has phenylpyruvate tautomerase and dopachrome tautomerase activity (in vitro), but the physiological substrate is not known. It is not clear whether the tautomerase activity has any physiological relevance, and whether it is important for cytokine activity (By similarity).
Pro-inflammatory cytokine. Involved in the innate immune response to bacterial pathogens. The expression of MIF at sites of inflammation suggests a role as mediator in regulating the function of macrophages in host defense. Counteracts the anti-inflammatory activity of glucocorticoids. Has phenylpyruvate tautomerase and dopachrome tautomerase activity (in vitro), but the physiological substrate is not known. It is not clear whether the tautomerase activity has any physiological relevance, and whether it is important for cytokine activity.

Catalytic Activity

3-phenylpyruvate = enol-phenylpyruvate
L-dopachrome = 5,6-dihydroxyindole-2-carboxylate

Biophysicochemical Properties

249 uM for phenylpyruvate
168 uM for p-hydroxyphenylpyruvate

Subunit

Homotrimer.
Homotrimer. Interacts with BNIPL (By similarity). Interacts with the CD74 extracellular domain. Interacts with COPS5 and with the CXCR2 extracellular domain (By similarity).
Homotrimer. Interacts with CXCR2 extracellular domain (By similarity). Interacts with the CD74 extracellular domain, COPS5 and BNIPL.

Miscellaneous

Serum levels of MIF are elevated in patients with severe sepsis or septic shock. High levels of MIF are correlated with low survival. Drugs that inhibit tautomerase activity protect against death due to sepsis.

Similarity

Belongs to the MIF family.

Keywords

Complete proteome   Cytokine   Cytoplasm   Immunity   Inflammatory response   Innate immunity   Isomerase   Reference proteome   Secreted   Acetylation   3D-structure   Direct protein sequencing  

Feature

chain  Macrophage migration inhibitory factor

Uniprot

H9IXV4   A0A076FF95   A0A194QZM4   A0A194PTW4   A0A2W1BVN6   A0A2A4JQL6   + More
A0A212EQM3   S4PMS5   A0A194R2T1   Q2F5Y8   I4DJQ2   A0A2A4K811   A0A1E1W0R3   A0A212FBP9   A0A2P6KW66   G3LVK0   B7U5G7   W4Y6E9   A0A131XER2   A0A1R7T086   A0A2H1W4E5   A0A386TX71   T1J2R3   A0A0L8G3L4   A0A099ZEA7   Q6I6Y5   A0A1I7S5K6   A0A1W7RA73   A0A220XIK4   A0A3M0JYC3   B5FYD5   U3JXM1   A0A3L8S7B1   B5FYD1   A0A0H4B3V7   B5FYD3   A0A0G3F8H3   E9G3A6   A0A226P0N5   A0A224Z418   Q02960   A0A091UZ15   A0A0B2V815   A0A023FHD3   A0A087UEY5   A0A093ST50   A0A093RLX4   A0A3B4DA24   R0JLZ8   A0A2P4TBZ7   A0A1V4JRN4   A0A023GEM0   G3MN30   A0A091JG14   L7M3U4   A0A131YE84   A0A218V3G4   A0A087R3E2   D2A508   A0A3B1KJP9   K7D8T1   A0A093I1E2   A0A023FF15   A9JSE7   A0A0K0FE13   A0A0N5BGX8   A0A2L2XX70   H3AS62   A0A0Q3S9D2   C3KIT6   E7CW70   A9QXF1   A0A1V4JRJ7   T1KBJ0   E4X404   A0A250Y9B6   G1QIN3   A0A1S3AKS0   A0A2K6DI86   A0A2K6M9X0   A0A0F7RQT8   A0A2K5YIM8   A0A0D9RF48   A0A2K5EMK3   A0A2I3M5Q0   A0A2K6NBK0   A0A2K5KZX3   A0A2K5PNE7   I2CYD8   A0A2I3TNA2   I4AY87   Q6DN04   Q4R549   P14174   H9H6Q2   Q0ZBS3   A0A0P4ZV47   K7BY30   A0A2K6GBA6  

EC Number

5.3.2.1

Pubmed

19121390    26354079    28756777    22118469    23622113    22651552    + More
22085783    21909270    17018643    30282656    25602707    21292972    24621616    28797301    7679497    23749191    22216098    25576852    26830274    18362917    19820115    25329095    26561354    9215903    21087669    19426810    21097902    28087693    25941635    26862561    25362486    25319552    15164055    16136131    24424397    2552447    8234256    7947826    8188240    15461802    14702039    15489334    12665801    1286669    7683862    11089976    11508429    11439086    12681488    12782713    15908412    17443469    19454686    19608861    21269460    22223895    22814378    24275569    25944712    8766818    8610159    8643551    10353846    11170644    17526494    19090677    23776208    17495919    17442392   

EMBL

BABH01015688    KF803647    AII16889.1    KQ461108    KPJ09046.1    KQ459593    + More
KPI96757.1    KZ149922    PZC77694.1    NWSH01000779    PCG74291.1    AGBW02013268    OWR43796.1    GAIX01003405    JAA89155.1    KQ460878    KPJ11555.1    DQ311284    ABD36229.1    AK401520    KQ459582    BAM18142.1    KPI98893.1    NWSH01000064    PCG80034.1    GDQN01010476    JAT80578.1    AGBW02009293    OWR51160.1    MWRG01004417    PRD30574.1    JN564748    AEN25591.1    FJ435176    ACJ65690.1    AAGJ04084949    GEFH01004011    JAP64570.1    KP734096    ALU63744.1    ODYU01006272    SOQ47961.1    MG572765    AYE92699.1    JH431806    KQ424157    KOF71483.1    KL891807    KGL79185.1    AB158366    BAD24819.1    GFAH01000352    JAV48037.1    MF278726    ASL05032.1    QRBI01000121    RMC06022.1    DQ213921    DQ213923    ACH44046.1    AGTO01010305    QUSF01000052    RLV97808.1    DQ213917    DQ213918    DQ213920    DQ213924    ACH44042.1    KP221196    AKN56918.1    DQ213919    ACH44044.1    KR136352    AKJ79139.1    GL732531    EFX85741.1    AWGT02000222    OXB73278.1    GFPF01010525    MAA21671.1    M95776    KL410318    KFQ95891.1    JPKZ01002261    KHN77607.1    GBBK01004344    JAC20138.1    KK119518    KFM75924.1    KL672332    KFW85704.1    KL225417    KFW71899.1    ADON01099402    ADON01099403    KB743518    EOA98340.1    PPHD01002752    POI33886.1    LSYS01006629    OPJ74821.1    GBBM01003124    JAC32294.1    JO843281    AEO34898.1    KK502027    KFP19502.1    GACK01006502    JAA58532.1    GEDV01010913    JAP77644.1    MUZQ01000064    OWK60250.1    KL226071    KFM07996.1    KQ971361    EFA05294.1    GABD01003748    JAA29352.1    KL206976    KFV87736.1    GBBK01004345    JAC20137.1    BC156031    IAAA01007423    IAAA01007424    LAA00622.1    AFYH01006212    LMAW01000512    KQL37913.1    BT082851    ACQ58558.1    HM775084    ADM86239.1    EU284114    FJ195326    ABX76741.2    ACI25609.1    OPJ74822.1    CAEY01001951    FN653024    FN655380    CBY23792.1    CBY38962.1    GFFW01004622    JAV40166.1    ADFV01132224    HF564796    CCP38001.1    HF564798    CCP38003.1    AQIB01154645    JV667310    AFJ71973.1    AACZ04005615    NBAG03000547    PNI15914.1    GQ891502    JQ846015    HF564790    ADO22364.1    AFM09726.1    CCP37995.1    AY656809    AB169695    M25639    L10612    Z23063    L19686    AF469046    EF611126    CR456520    AK311929    CR407644    CR541651    BT007148    DQ307455    CH471095    BC000447    BC007676    BC008914    BC013976    BC022414    BC053376    M95775    DQ639947    JX827473    KF888660    KF888661    ABG54274.1    AGK62342.1    AHI88423.1    GDIP01208148    JAJ15254.1    GABF01003136    JAA19009.1   

Proteomes

UP000005204    UP000053240    UP000053268    UP000218220    UP000007151    UP000007110    + More
UP000053454    UP000053641    UP000095284    UP000269221    UP000016665    UP000276834    UP000000305    UP000198419    UP000000539    UP000053283    UP000031036    UP000054359    UP000053258    UP000054081    UP000261440    UP000016666    UP000190648    UP000053119    UP000197619    UP000053286    UP000007266    UP000018467    UP000053584    UP000008143    UP000035680    UP000046392    UP000008672    UP000051836    UP000015104    UP000001073    UP000079721    UP000233120    UP000233180    UP000233140    UP000029965    UP000233020    UP000028761    UP000233200    UP000233060    UP000233040    UP000002277    UP000006718    UP000005640    UP000002280    UP000221080    UP000233160   

PRIDE

H9IXV4    Q2F5Y8    Q02960    Q6DN04    Q4R549    P14174    + More

Pfam

PF01187   MIF

Interpro

IPR014347   Tautomerase/MIF_sf        + More
IPR001398   Macrophage_inhib_fac       
IPR019829   Macrophage_inhib_fac_CS       

SUPFAM

SSF55331   SSF55331       

Gene 3D

3.30.429.10    

ProteinModelPortal

H9IXV4   A0A076FF95   A0A194QZM4   A0A194PTW4   A0A2W1BVN6   A0A2A4JQL6   + More
A0A212EQM3   S4PMS5   A0A194R2T1   Q2F5Y8   I4DJQ2   A0A2A4K811   A0A1E1W0R3   A0A212FBP9   A0A2P6KW66   G3LVK0   B7U5G7   W4Y6E9   A0A131XER2   A0A1R7T086   A0A2H1W4E5   A0A386TX71   T1J2R3   A0A0L8G3L4   A0A099ZEA7   Q6I6Y5   A0A1I7S5K6   A0A1W7RA73   A0A220XIK4   A0A3M0JYC3   B5FYD5   U3JXM1   A0A3L8S7B1   B5FYD1   A0A0H4B3V7   B5FYD3   A0A0G3F8H3   E9G3A6   A0A226P0N5   A0A224Z418   Q02960   A0A091UZ15   A0A0B2V815   A0A023FHD3   A0A087UEY5   A0A093ST50   A0A093RLX4   A0A3B4DA24   R0JLZ8   A0A2P4TBZ7   A0A1V4JRN4   A0A023GEM0   G3MN30   A0A091JG14   L7M3U4   A0A131YE84   A0A218V3G4   A0A087R3E2   D2A508   A0A3B1KJP9   K7D8T1   A0A093I1E2   A0A023FF15   A9JSE7   A0A0K0FE13   A0A0N5BGX8   A0A2L2XX70   H3AS62   A0A0Q3S9D2   C3KIT6   E7CW70   A9QXF1   A0A1V4JRJ7   T1KBJ0   E4X404   A0A250Y9B6   G1QIN3   A0A1S3AKS0   A0A2K6DI86   A0A2K6M9X0   A0A0F7RQT8   A0A2K5YIM8   A0A0D9RF48   A0A2K5EMK3   A0A2I3M5Q0   A0A2K6NBK0   A0A2K5KZX3   A0A2K5PNE7   I2CYD8   A0A2I3TNA2   I4AY87   Q6DN04   Q4R549   P14174   H9H6Q2   Q0ZBS3   A0A0P4ZV47   K7BY30   A0A2K6GBA6  

PDB

1GIF     E-value=1.00465e-12,     Score=171

KEGG

101743564    K07253 phenylpyruvate tautomerase [EC:5.3.2.1] | (RefSeq) MIF-like protein mif-2

PATHWAY

00350    Tyrosine metabolism - Bombyx mori (domestic silkworm)
00360    Phenylalanine metabolism - Bombyx mori (domestic silkworm)
01100    Metabolic pathways - Bombyx mori (domestic silkworm)

GO

GO:0042289   GO:2000343   GO:0010739   GO:0050178   GO:0009986   GO:0010760   GO:0050731   GO:0007569   GO:0032760   GO:0071157   GO:0090238   GO:0043406   GO:0042802   GO:0010629   GO:0005615   GO:0032269   GO:0030330   GO:0004167   GO:0002906   GO:0007166   GO:0008283   GO:0061081   GO:0043518   GO:1902166   GO:0005829   GO:0033033   GO:0070207   GO:0005654   GO:0005125   GO:0042056   GO:0002020   GO:0033138   GO:0001516   GO:0048146   GO:0090344   GO:0030890   GO:0070374   GO:0031666   GO:0005126   GO:0061078   GO:0050715   GO:0006954   GO:0045087   GO:0060117   GO:0043066   GO:0048598   GO:0005737   GO:0005576   GO:0050900   GO:0042327   GO:0019752   GO:0005102   GO:0031982   GO:0035722   GO:0043030   GO:1904813   GO:0070062   GO:0034774   GO:0043312  

PANTHER

PTHR11954  

Subcellular location

Secreted   Does not have a cleavable signal sequence and is secreted via a specialized, non-classical pathway. Secreted by macrophages upon stimulation by bacterial antigens (By similarity).   With evidence from 2 publications.
Cytoplasm   Does not have a cleavable signal sequence and is secreted via a specialized, non-classical pathway. Secreted by macrophages upon stimulation by bacterial antigens (By similarity).   With evidence from 2 publications.

Length:

147

Number of predicted TMHs:

0

Exp number of AAs in TMHs:

0.0138

Exp number, first 60 AAs:

0.00696999999999999

Total prob of N-in:

0.40708

outside

1  -  147

 

 

Pi

16.09742

Theta

19.511584

Tajima's D

-0.613216

CLR

0.137328

CSRT

0.222688865556722

Interpretation

Uncertain