SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00038
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Full name
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 2.692
 

Sequence

CDS
ATGGGGCTCACCCGGGTTGCGACTTCGCCCCTACGACCGAAGGTCGACTGGGAGCTCTTTAAGAGACGACTAGTCGACCTTCCCGTAATTCAGGACCCCAACACCCCTGAGGGGGTCGATGACGCGGCAGTCCGCCTTATCGACTCCATCAGGGGAGCGATTGACCAGGCGACGACTCTTGTGCCCAGCGGCGGGCCCAGAGGTAGACTCCCGGCCCATCTGAAGGCGATCATTCGCCGGAAGAGGGGCCTGAGGAGGCTCTGGGCGACAACTCGTTGTCCCAGGATCAAGCGCGAGCTTAATGAGTTGGAAGCGGAGTTGGCGGCGAAGATTAGCTCCTTTCGGGGCTATGCGTGGGAGGAACGGATTGAGGAGGCCCGTGAGGACCCCTCTTCCGTGTCCCTCCACCGACTTTGCCGCCAGCTCTCAAATCGGCCTGCCCCGACTTGTCCACTCGTGGACGAGAGGGGCAACCGATGCTTCTCGGCTCAGGCCCGCGCCGATGTCCTGGCCGCAATGCTGGAGCGGCAGTTCGTTCCGAATGACTCTGCACCCTCAGAGGCCGCATTCTACCAATCGGTGGAAGAGAGCGTAGCGAACCTACTCTCCTCCCCGGTGCCACCGTTGGGAGATGATGTTTTCATCACTCCCAGTGAATTGCGCCTCTCCATCAAGCGGATGAAGAGGCGCAAGGCGCCGGGTGAGGACGGTATTCCCTCCCTCGCATTCTTCCACTTCCCTGAAACGGTCGTGTCATACATGACACGGCTGTTCAATTCCATTCTGTCCACAGGACACTTCCCGGGAATTTGGAAATTGGGCAAGGTTATCGCCTTGCCCAAACCCGGCAAGGATAGGAGAAATCCCTCCAGTTACCGTCCGATCACCTTGCTGTCGCATGTGGGCAAGTTGTTCGAGAGGCTGCTGCTGAGAAGGGTGTCGCCGCACATCCTTCCCAGACCCGAGCAGTTCGGGTTTCGCAGCGGTCACTCGACAACGCTGCAATTGGTCCGCGTCATGCATCACTTGGCGGATCGGTCCAACGCGCGCCAGTACACGGCCGCAGTCTTTCTCGATATCGAGAAAGCCTTCGACCGTGTCTGGCATGCGGGACTGATCCACAAGCTGGTGCAGAACACGGACCTCCAGCACGCCTACGTGCGACTGCTGGGGTCGTACCTGGAGGGAAGATCCTTCTTTGTCGCGGTCGAGGGCGCCAAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCGCAGGGAAGCGTCCTGGCCCCACTCCTCTACGCTCTCTACACCAACGACATTCCCACGCTCGAGGGTAACCTCCAAGCGTGGGAAGTAGACGTGAAGTTGGCGCTGTTTGCCGACGACAGCGCCTACTTCTCGTCATCCAACGTCCCCTCTGCGGCCATTTTGAGGATGCAGAGGCTTTTGGACCTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGGTCAACGTGGGGAAGACTGCGGCTATCCTCTTCGGTCCGGTCCGCACAACAGTCGTCCCGGGACAGCTCAGTCTCCGTGGCGCTAATGTCGAGTTTAGATCCAGCGTCCGGTACTTGGGGGTCGATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAATAAGGCTTTGGCGGCCGCTCGCTGTGCGAGATTCCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGCCGGTCAGGACTAAGCTCGGCATTTATAAGACGTATGTCCGTTCCCGTATCACGTACGCAGCTGAGGCCTGGTATCACCTCATCCCGCAGGGTATGCGGGCGAGGTTACAGGTCCAGCAAAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAATGACGTAATCGCCCGGGATCTAGATGTGGAGTCGCTCGAGGAGTTCATCCGGAGGCTAGCTCGTAATCTTTACGAGCGGGCTGACGGTGGACCCCACGAGCACCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTCGGGCGCTACCAAGGGAGCTACTGGAACCCCCGGCTATGGTAAGATAG
Protein
MGLTRVATSPLRPKVDWELFKRRLVDLPVIQDPNTPEGVDDAAVRLIDSIRGAIDQATTLVPSGGPRGRLPAHLKAIIRRKRGLRRLWATTRCPRIKRELNELEAELAAKISSFRGYAWEERIEEAREDPSSVSLHRLCRQLSNRPAPTCPLVDERGNRCFSAQARADVLAAMLERQFVPNDSAPSEAAFYQSVEESVANLLSSPVPPLGDDVFITPSELRLSIKRMKRRKAPGEDGIPSLAFFHFPETVVSYMTRLFNSILSTGHFPGIWKLGKVIALPKPGKDRRNPSSYRPITLLSHVGKLFERLLLRRVSPHILPRPEQFGFRSGHSTTLQLVRVMHHLADRSNARQYTAAVFLDIEKAFDRVWHAGLIHKLVQNTDLQHAYVRLLGSYLEGRSFFVAVEGAKSSVRPVTAGVPQGSVLAPLLYALYTNDIPTLEGNLQAWEVDVKLALFADDSAYFSSSNVPSAAILRMQRLLDLLPQWLDRWRVAVNVGKTAAILFGPVRTTVVPGQLSLRGANVEFRSSVRYLGVDIDRSLRMTAHANKALAAARCARFLLRPVLASRLPVRTKLGIYKTYVRSRITYAAEAWYHLIPQGMRARLQVQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNLYERADGGPHEHLHNIAPLHARPPDGRALPRELLEPPAMVR

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
NWSH01000895    PCG73652.1    ABLF02017815    ABLF02008463    ABLF02021177    ABLF02027367    + More
ABLF02066338    GEZM01074951    JAV64378.1    ABLF02055645    ABLF02034467    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02023911    ABLF02041767    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02033522    GGMS01017914    MBY87117.1    ABLF02050434    ABLF02064867    ABLF02040650    ABLF02040651    ABLF02056776    ABLF02028535    ABLF02028545    GEZM01008457    JAV94772.1    ABLF02008677    ABLF02011967    ABLF02052409    ABLF02056408    GALX01005299    JAB63167.1    KK119261    KFM75202.1    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02017813    NEVH01014858    PNF27387.1    NEVH01007838    PNF34986.1    NEVH01006754    PNF36554.1    NEVH01019964    PNF22161.1    NEVH01002716    PNF41415.1    ABLF02042518    ABLF02057746    NEVH01027074    PNF13841.1    GGMR01019198    MBY31817.1    NEVH01009134    PNF33528.1    NEVH01021205    PNF19912.1    NWSH01000032    PCG80496.1    NEVH01011985    PNF31054.1    NEVH01006721    PNF37225.1    KQ459265    KPJ02064.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    NEVH01017559    PNF23833.1    NEVH01026386    PNF14434.1    NEVH01000280    PNF43672.1    NEVH01023962    PNF17612.1    NEVH01020071    PNF21969.1    KQ971729    KYB24751.1    NEVH01005938    PNF38077.1    KQ973342    KXZ75569.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NEVH01018383    PNF23463.1    NEVH01017470    PNF24199.1    NEVH01007443    PNF35684.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01003017    PNF40781.1    NEVH01023961    PNF17613.1    NEVH01001355    PNF42855.1    NEVH01010546    PNF32261.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GALX01005359    JAB63107.1    GEZM01053022    JAV74219.1    ABLF02003961    ABLF02059872    GFTR01008279    JAW08147.1    GBGD01000799    JAC88090.1    GGMR01000857    MBY13476.1    AY089343    AAL90081.2    NEVH01022639    PNF18527.1    GFTR01008038    JAW08388.1    PCG80497.1    GFTR01008262    JAW08164.1    GFXV01007093    MBW18898.1    NEVH01008277    PNF34262.1    NEVH01005277    PNF39135.1    GGMR01003407    MBY16026.1    GGMS01000737    MBY69940.1    JXUM01155316    KQ572171    KXJ68070.1    NEVH01006736    PNF36716.1    NEVH01000269    PNF43694.1    GBBI01003810    JAC14902.1    GFTR01008246    JAW08180.1    GBGD01000880    JAC88009.1    GGMS01008766    MBY77969.1    NEVH01019376    PNF22596.1    NEVH01016340    PNF25410.1    NEVH01007402    PNF35856.1    NEVH01026154    PNF14491.1    PNF27092.1    GBBI01004395    JAC14317.1    NEVH01021925    PNF19341.1    RPOV01000134    RPJ78669.1    NEVH01016302    PNF25823.1    M22874    M38643    GGMS01002992    MBY72195.1    NEVH01023979    PNF17579.1    AF081103    AAC72921.1    GFXV01000908    MBW12713.1    NEVH01020940    PNF20481.1    NEVH01019080    PNF22876.1    NEVH01017542    PNF24034.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03184   DDE_1
PF07727   RVT_2
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR004875   DDE_SF_endonuclease_dom       
IPR013103   RVT_2       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=2.95341e-05,     Score=116

Ontologies

Topology

Length:
685
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01063
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00052
outside
1  -  685
 
 

Population Genetic Test Statistics

Pi
5.188572
Theta
16.333077
Tajima's D
-0.549175
CLR
0
CSRT
0.229388530573471
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号