SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00035
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.524
 

Sequence

CDS
ATGCGTGTGTGCTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCCCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGAGGTGCCCTCCTCCCGGGCCTGAGCGTAATATGTTACGCGGACGACACGTTGGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACGGCTGGGGTGGCGCATGTCGTCGGCAAAATTAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGCTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCACCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATAGGTGGCGGGCTGAACTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCACGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCTGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCATTTTCCGGCTTACGCAGGTGCTCACTGGGCATGGTTGTTTCGGTGAGTTCCTGCACCGGATCACAGCCGAGCCGACGGCAGATTGCCACCATTGTGGTTGCGACTTGGACACGGCAGAGCATACGCTCGTCGCCTGCCCCGCATGGGAGGGATGGCGCCGTGTCCTCGTCGCAAAAATAGGAACCGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGGGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MRVCFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYRWRAELRARGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLIFRLTQVLTGHGCFGEFLHRITAEPTADCHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGTDLSLPSVVASMLGDDESWKAMLDFCGCTISQKEAAGRVRDAQSRRRRAGAREADLAQALAL

Summary

EMBL
AB090825    BAC57926.1    KZ150386    PZC71062.1    AB078935    BAC06462.1    + More
AB078930    BAC06454.1    AB078931    BAC06456.1    AB078929    BAC06452.1    KZ149896    PZC78733.1    D85594    BAA19776.1    LBMM01012027    KMQ86470.1    LBMM01005707    KMQ91279.1    KQ460685    KPJ12887.1    LBMM01006954    KMQ90166.1    LBMM01019839    KMQ83438.1    LBMM01019838    KMQ83439.1    LBMM01006657    KMQ90417.1    LBMM01006671    KMQ90407.1    LBMM01005733    KMQ91252.1    LBMM01008861    KMQ88580.1    LBMM01004272    KMQ92618.1    LBMM01006063    KMQ90967.1    LBMM01006725    KMQ90373.1    LBMM01002052    KMQ95336.1    LBMM01008682    KMQ88705.1    LBMM01014132    KMQ85305.1    LBMM01009738    KMQ87908.1    LBMM01007036    KMQ90099.1    LBMM01004634    KMQ92224.1    QOIP01000031    RLU14697.1    LBMM01005948    KMQ91066.1    QOIP01000010    RLU18098.1    LBMM01002480    KMQ94776.1    LBMM01014956    KMQ84982.1    LBMM01015018    KMQ84954.1    LBMM01003245    KMQ93755.1    LBMM01008448    KMQ88867.1    LBMM01015025    KMQ84953.1    LBMM01004505    KMQ92346.1    LBMM01003988    KMQ92922.1    LBMM01021647    KMQ83033.1    LBMM01007425    KMQ89740.1    LBMM01007659    KMQ89538.1    LBMM01014122    KMQ85315.1    LBMM01008422    KMQ88894.1    LBMM01009527    LBMM01009515    KMQ88059.1    KMQ88067.1    LBMM01005465    KMQ91492.1    LBMM01004697    KMQ92167.1    LBMM01012412    KMQ86235.1    LBMM01005216    KMQ91703.1    GGMR01000779    MBY13398.1    LBMM01005474    KMQ91485.1    LBMM01008278    KMQ89009.1    KMQ94772.1    GECU01032129    JAS75577.1    ABLF02011238    GGMR01015159    MBY27778.1    LBMM01006496    KMQ90570.1    ABLF02005203    ABLF02041316    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    GGMR01014195    MBY26814.1    GGMR01004600    MBY17219.1    GGMR01015354    MBY27973.1    GFXV01001748    MBW13553.1    ABLF02004597    ABLF02041324    GGMR01019609    MBY32228.1    ABLF02004854    ABLF02041317    ABLF02014530    ABLF02018586    ABLF02058000    ABLF02041886    KQ971864    EFA13315.2    ABLF02034925    GFXV01002090    MBW13895.1    GBHO01002982    JAG40622.1    GBXI01013438    JAD00854.1    ABLF02009991    ABLF02009992    ABLF02054952    LBMM01012595    KMQ86127.1    GALX01004785    JAB63681.1    KQ972691    KXZ75807.1    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    ABLF02026953    GFXV01002242    MBW14047.1    ABLF02010223    GGMR01006838    MBY19457.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
425
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.18409
Exp number, first 60 AAs:
0.60938
Total prob of N-in:
0.04639
outside
1  -  425
 
 

Population Genetic Test Statistics

Pi
2.848154
Theta
2.197883
Tajima's D
-1.395895
CLR
0
CSRT
0.0616469176541173
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号