SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00032
Pre Gene Modal
BGIBMGA002306
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 2.177
 

Sequence

CDS
ATGTTAACAAACGCGGACACGGCTCGTTTAGTTTACTTTAGTTACTTCCACAGTGTCATGTCCTATGGCATTTTGCTATGGGGCAATGCGGCCGATGTAGAAATGATATTTATTCTGCAGAAAAGAGCTATACGTGCTATTTATAACATGCACTCAAGGGAATCCCTGAGGGAGAAATTTAAAGAAATTAAAGTTCTCACTATGCCATCCCAGTACATTTTTGAAAATTTGATATTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCACTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCTGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGGATTGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGCACCTGGTCCCTCGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCTGTGTGGGGCCAGTCCCTGGCCGCGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCACCTTGGGCTCTGGAAGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTGACCTTCGCGCCCGGGGCGTGGCGTGTCCCAGCCACAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGGCGGCTGGCTGATCCTTCGGCCGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCAGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGATTGCGACTTGGACACGGCAGAGCATACGCTCGTCGCTTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAGTAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MLTNADTARLVYFSYFHSVMSYGILLWGNAADVEMIFILQKRAIRAIYNMHSRESLREKFKEIKVLTMPSQYIFENLIFVGKIRRLGLDVALSKSEAMWFHRPLRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQHLVPRDAPSLYGGGAINGPIRGACVGPVPGRGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWALEAEALAADYQWRADLRARGVACPSHSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIRAEPTAECHHCDCDLDTAEHTLVACPAWEGWRRVLVAKVGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQSRRRRAGAREADLAQALAL

Summary

EMBL
AB090825    BAC57926.1    KZ150386    PZC71062.1    AB078935    BAC06462.1    + More
AB078930    BAC06454.1    AB078931    BAC06456.1    AB078929    BAC06452.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    LBMM01008861    KMQ88580.1    GL450953    EFN80213.1    LBMM01014132    KMQ85305.1    LBMM01006657    KMQ90417.1    LBMM01006954    KMQ90166.1    LBMM01005733    KMQ91252.1    LBMM01004272    KMQ92618.1    LBMM01019839    KMQ83438.1    LBMM01008682    KMQ88705.1    LBMM01006671    KMQ90407.1    LBMM01019838    KMQ83439.1    LBMM01006662    KMQ90413.1    LBMM01006725    KMQ90373.1    QOIP01000010    RLU18098.1    LBMM01007036    KMQ90099.1    LBMM01002052    KMQ95336.1    LBMM01004634    KMQ92224.1    QOIP01000031    RLU14697.1    LBMM01003245    KMQ93755.1    LBMM01004505    KMQ92346.1    QOIP01000002    RLU25407.1    LBMM01008349    KMQ88951.1    LBMM01003988    KMQ92922.1    LBMM01002480    KMQ94776.1    LBMM01005948    KMQ91066.1    LBMM01015018    KMQ84954.1    LBMM01014956    KMQ84982.1    LBMM01015025    KMQ84953.1    LBMM01012412    KMQ86235.1    LBMM01005465    KMQ91492.1    LBMM01008278    KMQ89009.1    LBMM01007425    KMQ89740.1    LBMM01008422    KMQ88894.1    LBMM01004697    KMQ92167.1    LBMM01014122    KMQ85315.1    GGMR01011974    MBY24593.1    ABLF02006132    ABLF02005203    ABLF02041316   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
413
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
19.1604799999999
Exp number, first 60 AAs:
18.92435
Total prob of N-in:
0.89402
POSSIBLE N-term signal
sequence
inside
1  -  11
TMhelix
12  -  31
outside
32  -  413
 
 

Population Genetic Test Statistics

Pi
21.132105
Theta
20.714519
Tajima's D
-0.444995
CLR
0.084311
CSRT
0.256437178141093
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号