SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO00001
Annotation
PREDICTED:_uncharacterized_protein_LOC106648510_[Trichogramma_pretiosum]
Full name
Galactose-1-phosphate uridylyltransferase      
Location in the cell
Nuclear   Reliability : 1.934
 

Sequence

CDS
ATGGAGGCAAACGAACAATTAGTAAGAGAAGAAAATACACTGTTACTACAACAAAATGCCATCCTAAAGGCTGAATTACAAAAACTTAAAATGCAAGGCATCGATAAAACGGACCCACCCCCCACAGACCCATTATTTCCTCAACCTACGTCAGTATGCAGAGTAGCCATAAAACTTCCTCCCTTCTGGCCTGATCGGCCTGCAATTTGGTTTGCTCAGGTAGAGGCACAGTTCTCGATTTCAGGCATCTCCGCTGACCTGACTAAATTTAACTACGTGATTGCTCAGTTAGATACCCGAGTTATTGGGGAGGTAGAAGACATTATTCTCCAACCACCACCAGAGGACAAATATGGTCGCCTCAAATCCGAGTTGATCCGTAGGTTGTCCACGTCTGAGGAGCAACGTGTCAGGCAACTTGTCAGTGATGTTGAGTTGGGTGACCGCCGTCCTTCGCAGTTTTTACGTCATCTTAGATCATTGGCAGGAAACACCCTCACTGATGAAAATTTGCTTCGCCAGCTATGGATGCGTCGCCTCCCACAACATCTCCAAGCAATTTTGGCCGCCCAATCAGAACTCTCGCTGGACAAAGTCGCTGAGCTAGCGGACAAAATTTTGGAAGTTTCGCCTGTGTATTCAACCATGTACCTGGACGCCGCCGCCACCTTCGGAAAACGACAAAAGCAGTCAATGATGGCGACGTCTGACTGCTTAAAGGAGAGTCGCCGATTATTTGTCACCGAAAGCGCAACCAAGCGCCGTTTTTTAATAGACACAGGCTCCGACCTCTCCTGTTACCCATACCAGTGGTTAGCAAATAAGCCGGTACGTTCAAACTATACGTTAGCGGCTGCCAATGGTAGTGAGATACGCACTTTTGGTCACATAGAAATGGCGCTTAATTTGGGGCTACGCCGCACATTTCAATGGCGATTTATTATCGCTGACGTCAACACCGCCATCATCGGCTCCGATTTTCTGGCGCACTATCGGTTGTTGCCAGATTGTGCCAGTAAGAGACTCGTCGATAGCATTACCGGGTTGTCATGCGTTGCTGCCGTCGCTGTCTTAGACCAGACCAGCGTCAAAGTTGTCTGCGCTCCGTCATCCCAATTTAGTGCACTTCTTGCGGAATTTCCTTCCATTACGAAGCCACCAGGACTTATTCGTGAGCCGAAGCATAACACAGTTCATTATATTCTAACCACTGAGGGCGCCCCAGTCTCTTGTCGTCCTAGACGTCTGGCACCTCAAAAACTTCAAGAGGCCAAAAAGGTTTTTGATGATATGGTACAGTGCGGGACAGCCAGACCTTCGAAAAGTTCGTGGTCTTCTCCACTTCATATGGTCCCTAAGCGCGACGGCACCTGGCGACCCTGCGGCGATTATCGTGCGTTGAATTCACGTACCATACCTGACAGGTACCCAGTTCGCCATATCGGTGACGTTGGCCATAACATATCTGGGTGTAGTATATTTAGTACCATCGACCTCGTTAAGGCATATCAGCAAATTCCTGTTGCGCCTGAGGATATCTGTAAAACCGCCATCATAACACCCTTCGGACTCTACGAATTTAATTACATGACTTTTGGTCTACGCAACGCAGGCCAAACGTTTCAAAGATTTATAGACGAAGTTGTCCAAGGTCTCGATTTTTGCTTTGCGTACGTTGACGACATATTAGTGTATTCCCGTGATGCTCTTCAACATGCTGCACACCTTCGTACTCTTTTCAAGCGATTTGAAGATTACGGAATCGTTATTAATCCAGCAAAATGCGTGTTTGGTGCTCCTGAGGTTACTTTTCTCGGAAACAGAATATCCGCCGACGGAACACAACCACCATCAGAGCGCATTCAAGCTCTAAAAGATTTTCCTCTACCACAGACTGTACAAGGACTCCGTCGTTTCATTGGGATGGTTAATTATTATCGCCGATTTCTGCGCAATGCGGCCAAGTTACAAGCACCGCTAGTCAACGCGATCGTGGCCACTGGAGGTAAAGGTCTCACACCGATCACTTGGACACCTGAGCTCGAAGAATGCTTTAATGCCTGTAAAGATAGCTTGTCATCTGCAGCTCTGTTGGCACACCCTTTGCCTAACGCTGAACTAGGGCTTTTCACCGACGCTTCCAGTTCTCACGTTGGTGCCTGCCTTCAACAGAAAGTCGGTGATGCTTGGCAACCCCTGGGTTTCTTTAGTAAAAAGCTGAATCCCCGACAGTGCCAGTGGCCAGCATACTACCGAGAACTTCTTGCGGTATATGAGAGTGTGCAACATTATCGACACTTCCTAGCCGCACAGCACGTAACGATTTATACGGACCATAAGCCATTAGTTTATGCGTTCTCGCAACGTCGCGAAAGGCTTCCTCCGGTACAGTTAAATCAACTGTCTTTTATTTCGCAGTTTACCACGGACATTGTCCATATAAAAGGGGAGGACAATACGGTGGCGGACGCCATGTCCCGCATCGAAGCTGTTAGTTTTGAAACTGACCATTCTGCTCTCTCCGCTTGCCAAAAACTTGACGACGAATTGAAAAAGTATCGTAACGATGCGAATTCTTCTCTAAAACTAGAGAACGTCGTAGTTCCTGGCACAAACACTGTTTTGGTCTGCGACATGTCAACAGGGCGACCACGCCCATTTGTATCGGAACCTATGCGAAAGAAGATTTTTGCTCAGCTACATAATCTTAGCCATCCTGGTACTAGATCAACCATTCGATTGATCTCCGACCGTTTCGTGTGGCCTGGCATTGCCAAAGATTGCCGTTATTGGTGCCAAACCTGCGTTGCTTGCCAGCGAAGTAAGGTGACGCGGCATATAAAATCTCCACTTGGACACTTCTCCAGTCCTACGTCTCGACTGAAGCATGTCCATATTGACATCATAGGCCCTCTTCCATCTTGTTCTGACTTCCAATACTGCCTGACTGCTGTGGATCGCTACACTCGATGGCCCGAAGTTTGGCCTATGCACGGAATAACAGCAGAAGAAGTGGCAAGCACCTTTGTAGCCGGTTGGATTGCTCGATTCGGAGTACCTGCTGTCATCACTACCGACCAGGGACGACAGTTCGAGTCGGACCTTTTCAGACGCCTTACTAATTTATGTGGTACTAAACGTATACGCACTACTAGTTACCACCCTTGTGCCAATGGGCTCGTGGAGCGCATGCATAGACAATTAAAGGCTTCTCTGATGTGTTATGATGATTCGTGGTTGAATGCATTACCTTTGGTCTTATTAGGAATGCGTTCGGCTTTTAAAGAAGATCTACAAGCAACAGTAGCGGAATTGCTTTACGGAGAAACATTAACGCTTCCAGGGGAACTGTTAGTACCTCCCAGTCCTTCTGGTTTCGAGGACCCGACGGATTTTGTCGTAAAGTTAAGACAGCGTATGTCTAAATTGCGTCCCACTCCATGTTCCTCCCACACTAAACCATCACCTTTCATATTTAAAAATCTTTCCACTGCCTCTCATGTCATGCTCAGGGAGGATTCGGTTAGACGTTCAATGCAACCACCTTACTCTGGTCCTCATAGAGTTATATCTAGAGCCGAGGACGGAAAAACGTGGTCGATTGATGTAAAAGGGAAACAGGTGACGGTCAGTGTCGACAGAATTAAGCCAGCTTTCGTCGAGCATTCTTTAGTAGATCTCGTTCCAGCACCAGCACCGCGGGTTTCTGTGCCTCAACCAGCGCAACCGGATGCTACTAATGTCCCTTCATGTATTCCCTCACTATTATTTTGGCATACTCATAAATAG
Protein
MEANEQLVREENTLLLQQNAILKAELQKLKMQGIDKTDPPPTDPLFPQPTSVCRVAIKLPPFWPDRPAIWFAQVEAQFSISGISADLTKFNYVIAQLDTRVIGEVEDIILQPPPEDKYGRLKSELIRRLSTSEEQRVRQLVSDVELGDRRPSQFLRHLRSLAGNTLTDENLLRQLWMRRLPQHLQAILAAQSELSLDKVAELADKILEVSPVYSTMYLDAAATFGKRQKQSMMATSDCLKESRRLFVTESATKRRFLIDTGSDLSCYPYQWLANKPVRSNYTLAAANGSEIRTFGHIEMALNLGLRRTFQWRFIIADVNTAIIGSDFLAHYRLLPDCASKRLVDSITGLSCVAAVAVLDQTSVKVVCAPSSQFSALLAEFPSITKPPGLIREPKHNTVHYILTTEGAPVSCRPRRLAPQKLQEAKKVFDDMVQCGTARPSKSSWSSPLHMVPKRDGTWRPCGDYRALNSRTIPDRYPVRHIGDVGHNISGCSIFSTIDLVKAYQQIPVAPEDICKTAIITPFGLYEFNYMTFGLRNAGQTFQRFIDEVVQGLDFCFAYVDDILVYSRDALQHAAHLRTLFKRFEDYGIVINPAKCVFGAPEVTFLGNRISADGTQPPSERIQALKDFPLPQTVQGLRRFIGMVNYYRRFLRNAAKLQAPLVNAIVATGGKGLTPITWTPELEECFNACKDSLSSAALLAHPLPNAELGLFTDASSSHVGACLQQKVGDAWQPLGFFSKKLNPRQCQWPAYYRELLAVYESVQHYRHFLAAQHVTIYTDHKPLVYAFSQRRERLPPVQLNQLSFISQFTTDIVHIKGEDNTVADAMSRIEAVSFETDHSALSACQKLDDELKKYRNDANSSLKLENVVVPGTNTVLVCDMSTGRPRPFVSEPMRKKIFAQLHNLSHPGTRSTIRLISDRFVWPGIAKDCRYWCQTCVACQRSKVTRHIKSPLGHFSSPTSRLKHVHIDIIGPLPSCSDFQYCLTAVDRYTRWPEVWPMHGITAEEVASTFVAGWIARFGVPAVITTDQGRQFESDLFRRLTNLCGTKRIRTTSYHPCANGLVERMHRQLKASLMCYDDSWLNALPLVLLGMRSAFKEDLQATVAELLYGETLTLPGELLVPPSPSGFEDPTDFVVKLRQRMSKLRPTPCSSHTKPSPFIFKNLSTASHVMLREDSVRRSMQPPYSGPHRVISRAEDGKTWSIDVKGKQVTVSVDRIKPAFVEHSLVDLVPAPAPRVSVPQPAQPDATNVPSCIPSLLFWHTHK

Summary

Catalytic Activity
alpha-D-galactose 1-phosphate + UDP-alpha-D-glucose = alpha-D-glucose 1-phosphate + UDP-alpha-D-galactose
Similarity
Belongs to the galactose-1-phosphate uridylyltransferase type 1 family.
EC Number
2.7.7.12
EMBL
LBMM01001181    KMQ96765.1    LBMM01012479    KMQ86204.1    LBMM01013040    KMQ85849.1    + More
AAGJ04130731    GBXI01015889    JAC98402.1    LBMM01009142    KMQ88359.1    ABLF02030693    ABLF02030697    AAGJ04112098    LBMM01013103    KMQ85815.1    AAGJ04001742    GBXI01017046    JAC97245.1    KQ971355    EFA07205.2    EF426679    ABP48077.1    KL367778    KFD59660.1    AAGJ04164195    AAGJ04164196    AAGJ04164197    KL367543    KFD65158.1    GEGO01004484    JAR90920.1    KL367544    KFD65142.1    LN877232    CTR11708.1    GGLE01003443    MBY07569.1    GEGO01003687    JAR91717.1    AAZX01006801    AAZX01023483    GBXI01003773    JAD10519.1    KQ973093    EFA13472.2    GEGO01004649    JAR90755.1    LBMM01012567    KMQ86146.1    GEGO01003506    JAR91898.1    LBMM01012134    KMQ86388.1    GFDL01003994    JAV31051.1    GDKW01003376    JAI53219.1    GGLE01001814    MBY05940.1    KL367655    KFD60653.1    JYDR01000002    KRY79251.1    JYDT01000067    KRY86703.1    GEGO01004475    JAR90929.1    LBMM01012160    KMQ86374.1    GGFK01003401    MBW36722.1    GGFK01003442    MBW36763.1    ABLF02058233    AAZX01009606    KL363241    KFD51254.1    GEGO01000286    JAR95118.1    AAZX01023279    GFPF01012375    MAA23521.1    JWZT01003175    KII67485.1    JWZT01004124    KII64665.1    JWZT01005177    JWZT01001778    KII61927.1    KII71382.1    JWZT01002058    KII70465.1    GACK01008900    JAA56134.1    GEGO01001281    JAR94123.1    KL363373    KFD46409.1    AAZX01013940    JYDJ01000353    KRX36608.1    GBYB01009311    JAG79078.1    GDHF01021808    JAI30506.1    GDHF01001116    JAI51198.1    GDHF01014424    JAI37890.1    GEDV01001796    JAP86761.1    AAZX01004786    FN356213    CAX83702.1    MRZV01001828    PIK35719.1    KL367479    KFD72009.1    ABLF02005645    ABLF02042063    GEGO01004686    JAR90718.1    JWZT01001363    KII72172.1    ABLF02006352    ABLF02013150    ABLF02013854    ABLF02041505    DF142933    GAA49140.1    AAGJ04000250    JYDV01000002    KRZ45603.1    AY013565    AAK07486.1    AY013563    AAK07485.1    AY013569    AAK07487.1    LBMM01012633    KMQ86092.1    BK004070    DAA04500.1    KL367552    KFD64647.1    CABG01000050    CAZ37786.2    ABLF02057446    ABLF02059301    KL367492    KFD69854.1    NIVC01003188    PAA52757.1    BK004066    DAA04495.1    BN000802    CAJ00250.1    ABLF02040931    ABLF02040938    KL367664    KFD60497.1    AAGJ04172791    JYDI01000020    KRY58560.1    AAZX01023264    KRY58561.1    KL363200    KFD55401.1    JYDH01000101    KRY32299.1    KL363454    KFD45607.1    QPMK01000035    RDD64024.1   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF01087   GalP_UDP_transf
PF00078   RVT_1
PF00665   rve
PF17917   RT_RNaseH
PF00176   SNF2_N
PF00271   Helicase_C
PF05918   API5
PF13359   DDE_Tnp_4
PF02709   Glyco_transf_7C
PF13733   Glyco_transf_7N
PF00013   KH_1
PF00077   RVP
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR000477   RT_dom       
IPR034132   RP_Saci-like       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR005849   GalP_Utransf_N       
IPR001969   Aspartic_peptidase_AS       
IPR019779   GalP_UDPtransf1_His-AS       
IPR001995   Peptidase_A2_cat       
IPR001937   GalP_UDPtransf1       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036265   HIT-like_sf       
IPR041373   RT_RNaseH       
IPR013032   EGF-like_CS       
IPR016024   ARM-type_fold       
IPR014001   Helicase_ATP-bd       
IPR001650   Helicase_C       
IPR008383   API5       
IPR038718   SNF2-like_sf       
IPR027417   P-loop_NTPase       
IPR000330   SNF2_N       
IPR027806   HARBI1_dom       
IPR027791   Galactosyl_T_C       
IPR036612   KH_dom_type_1_sf       
IPR003859   Galactosyl_T       
IPR004087   KH_dom       
IPR004088   KH_dom_type_1       
IPR027995   Galactosyl_T_N       
IPR029044   Nucleotide-diphossugar_trans       
IPR018061   Retropepsins       
SUPFAM
SSF53098   SSF53098        + More
SSF54197   SSF54197       
SSF56219   SSF56219       
SSF50630   SSF50630       
SSF52540   SSF52540       
SSF48371   SSF48371       
SSF54791   SSF54791       
SSF53448   SSF53448       
PDB
4OL8     E-value=1.44931e-66,     Score=647

Ontologies

Topology

Length:
1262
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0209299999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00071
outside
1  -  1262
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
1.22088
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号